Journal Search Engine
Search Advanced Search Adode Reader(link)
Download PDF Export Citaion korean bibliography PMC previewer
ISSN : 2288-1115(Print)
ISSN : 2288-1123(Online)
Korean Journal of Ecology and Environment Vol.54 No.3 pp.229-239
DOI : https://doi.org/10.11614/KSL.2021.54.3.229

Phylogenetic and Morphological Comparison between Thamnaconus septentrionalis and T. modestus Collected in Southwest Seashore

Tae-Sik Yu1, Kiyun Park2, Kyeong-Ho Han1, Ihn-Sil Kwak2,3*
1Department of Fishery Science, Chonnam National University, Yeosu 59626, Republic of Korea
2Fisheries Science Institute, Chonnam National University, Yeosu 59626, Republic of Korea
3Department of Ocean Integrated Science, Chonnam National University, Yeosu 59626, Republic of Korea
* Corresponding author: Tel: +82-61-659-7148, Fax: +82-61-659-7149 E-mail: iskwak@chonnam.ac.kr
15/09/2021 17/09/2021 18/09/2021

Abstract


Thamnaconus modestus, distributed in the Northwest Pacific, has high economic value and is used in various seafood. In this study, the morphological and genetic characteristics of T. modestus and T. septentrionalis were compared and analyzed. We observed the external and internal morphology of T. modestus, sketched skeletal elements, and analyzed phylogenetic evolutionary relationships using the cytochrome c oxidase subunit I (COI) gene on mitochondrial DNA compared to T. septentrionalis. The T. modestus observed in this study had blackish-brown patterns irregularly scattered on the gray-brown body, and the fins were blue-green. Genetic analysis results based on the COI sequences of T. modestus showed seven types of base sequence variation; however, the homology was more than 98.8%. In addition, as a result of comparison of the COI nucleotide sequences and phylogenetic analysis in Tetraodontiformes, two T. septentrionalis sequences (JN813099, MW485059) were similar to T. modestus with 99% homology, and the other two T. septentrionalis sequences (EF607583, KP267619) were similar to those of species belonging to another genus Thamnaconus with 95% homology with T. modestus. It was not easy to classify the species based on morphological characteristics, and phylogenetic analysis between T. modestus and T. septentrionalis confirmed the difference in classification. These results provide the external and internal morphology of T. modestus and will be used as important information for the taxonomic study of T. modestus and T. septentrionalis.



서남해에서 채집된 말쥐치 (Thamnaconus modestus)와 유사종 (T. septentrionalis)의 형태 및 계통유전학적 비교

유 태식1, 박 기연2, 한 경호1, 곽 인실2,3*
1전남대학교 수 산과학과
2전남대학교 수 산과학연구소
3전남대학교 해양융합학과

초록


    서 론

    어류의 종 분류는 계수 및 계측과 같은 외부 형태 분류 를 기반으로 하며 (Strauss and Bond, 1990;Triantafyllidis et al., 2011), 형태 분류가 어려울 경우 내부 골격과 DNA 등 다양한 방법을 이용하여 종을 분류한다. 그중 내부 골격 의 형태와 특징은 계통학 연구에서 중요한 역할을 하며, 때 로는 분류학적 수준에서 유용한 계통발생 정보를 제공하 기도 한다 (Coast, 2012). 또한, DNA 서열 분석은 계통발 생 관계를 추론하며 형태학적 특성만으로 구별하기 어려 운 분류군을 동정하는 데 유용한 분류학적 방법으로 (Lee et al., 2012), 국내에서는 미꾸리과 어류 (Cobitidae, Park and Lee, 1991), 숭어목 어류 (Mugilidae, Kim et al., 2003), 실 고기목 어류 (Syngnathiformes, Koh and Song, 2004), 잔 가시고기 (Pungitius kaibarae, Jang et al., 2006), 자리돔 과 어류 (Pomacentridae, Koh and Park, 2007), 꼼치과 어류 (Liparidae, Song et al., 2015) 등 다양한 연구가 미토콘드리 아 DNA (mtDNA)를 활용하여 계통 발생과 분류에 관해 진 행되어왔다.

    복어목 (Tetraodontiformes) 쥐치과 (Monacanthidae)에 속 하는 말쥐치 (Thamnaconus modestus)는 몸 전체에 흑갈색 무늬가 불규칙하게 산재해 있으며, 지느러미가 청록색을 띠 는 특징을 가지고 있다. 또한, 한국, 일본 및 중국 연안을 포 함한 북서태평양 열대와 아열대 해역의 수심 50~100 m의 연안에 서식한다고 알려져 있으며 (Kim et al., 2013;Froese and Pauly, 2021), 한국과 일본에서 횟감과 건어포, 조림 등 다양한 식품으로 이용되는 경제적 가치가 매우 높은 어종이 다 (Baeck et al., 2012). 말쥐치와 형태적으로 비슷한 유사 종 (T. septentrionalis)은 1874년 중국에서 처음 보고된 종으 로, 중국, 한국 및 일본에 분포하며, 말쥐치와 마찬가지로 상 업적으로 매우 중요한 해양 어류로 알려져 있지만 (Ni and Wu, 2006), 국내에 보고된 적이 없는 어종이다. 과거 일본 (Masuda et al., 1984;Nakabo, 2000)에서는 말쥐치와 유사 종 (T. septentrionalis)이 같은 종이나 어류학자의 의견이 갈 려 중국과 일본에서는 T. septentrionalis로 쓰이고 한국에 서는 T. modestus로 쓰고 있다고 보고하였으나, 이후 대만 (Shen et al., 1993)에서는 말쥐치와 유사종을 형태 형질은 비슷하지만 유사종 (T. septentrionalis)의 체색이 더 푸르다고 언급하며 다른 종으로 분류하여 현재까지 서로 다른 종으로 구분되고 있다 (Matsuura, 2015).

    국내에서 말쥐치에 관한 연구는 성숙과 산란 (Nam et al., 2018;Choi et al., 2020), 식성 (Baeck et al., 2012), 난과 자 치어의 형태 발달 (Lee et al., 2000a;Han et al., 2018), 유전 적 구조, 변이 및 다양성에 대한 연구가 진행되어왔다 (An et al., 2013;Yang et al., 2019;Gwak et al., 2021). 또한, 쥐치 과 어류의 분류에 관한 연구는 외부 형태, 유전 및 내부 골 격 등 다양하게 수행되었음에도 불구하고 (Berry and Vogele, 1961;Hutchins, 1977;Tyler, 1980;Holcroft, 2005;de Lima et al., 2011), 말쥐치와 유사종 (T. septentrionalis)의 형태 및 유전적 비교에 관한 연구는 전무한 실정이다. 특히, 쥐치과 어류는 서식 환경에 따라 색의 변이가 심하고, 유전적 변이 가 다양한 특성을 가지고 있어 (Okaichi et al., 1958;Gilby et al., 2014), 체색의 차이만으로 두 종을 분류하는 것은 종 동정에 있어 오류를 범할 수 있다. 따라서, 본 연구는 서해 와 남해에서 채집된 말쥐치의 외부 형태와 골격의 특징을 관 찰하고 채집된 시료의 미토콘드리아 DNA의 cytochrome c oxidase I (COI) 분석을 통해 말쥐치의 유전적 다양성을 분석 하고, 기존 NCBI에 보고된 유사종 (T. septentrionalis)과 형 태 및 계통유전학적 비교를 통해 두 종의 분류학적 위치를 검토하는 데 있어 주요한 정보를 제공하고자 한다.

    재료 및 방 법

    1. 시료 채집 및 측정

    본 연구에 사용된 말쥐치 시료는 2019년 11월부터 2020 년 3월까지 서해 (보령 연안, 5개체)와 남해 (통영 및 제주 연 안, 26개체)에서 연안개량안강망, 저층트롤 및 정치망을 이 용하여 채집하였다. 채집된 시료는 드라이아이스에 보관하여 실험실로 운반하였으며, 각 개체의 전장 (Total length, TL), 체장 (Standard length, SL), 체고 (Body depth, BD), 두장 (Head length, HL)을 측정 후 전장에 대한 백분비로 나타내 었고, 등지느러미, 가슴지느러미 및 뒷지느러미의 기조 수를 각각 계수하였다. 이후 가슴지느러미와 등 근육을 적출하여 - 80℃ Deep freezer (Thermo Fisher Scientific)에 보관하였 다.

    2. 골격 관찰

    말쥐치 골격을 관찰하기 위해 시료를 약 10~15분간 삶 아서 살을 제거하였으며, 견대부 (Shoulder girdle), 악골 (Jaw bone), 구개익상부 (Palato-pterygoid region), 새개부 (Operculum region), 설궁부 (Hyoid arch), 두개골 (Cranium) 및 척추골 (Vertebrae)로 나누어 채골하였다. 이후 부위별로 촬영 및 스케치를 진행하였으며, 골격의 명칭은 Kim (1989) 에 따랐다.

    3. DNA 추출

    말쥐치 DNA 추출은 AccuPrep genomic DNA extraction kit (Bioneer, Korea)에 제공되는 프로토콜에 따라 진행하였 다. 1.5 mL EP tube에 TL Buffer 200 μL를 넣고 homogenizer를 이용하여 근육을 균질하게 만들어 Proteinase K 20 μL 와 RNase 10 μL를 넣어 단백질과 RNA를 제거하였다. 이 후 60℃의 Incubator에 한 시간 동안 용해과정을 거치고 GB Buffer 200 μL, 에탄올 400 μL를 넣어 원심분리 후 상등액을 취하였다. WA1과 WA2 buffer를 이용하여 washing 후 EA buffer로 DNA를 elution하였다. 추출한 DNA 농도 측정은 NanoDrop ND-2000 spectrophotometer (Implen, Munich, Germany) 를 이용하여 확인 후 - 80℃ deep-freezer (Thermo Fisher Scientific)에 보관하였다.

    4. 말쥐치 COI 유전자의 PCR 증폭 및 염기서열 분석

    말쥐치의 미토콘드리아 DNA에서 COI 유전자 증폭을 위 해 Taq DNA polymerase (Bioneer, Korea)를 사용하여 PCR (Polymerase chain reaction)을 진행하였다. 증폭에 이용한 Primer는 FishF1-5′TCAACCAACCACAAGACATTGG CAC3′와 FishR1-5′TAGACTTCTGGGT GGCCAAAGAA TCA3′이다 (Ward et al., 2005). PCR mixture (20 μL)에는 primer F1과 R1을 각각 1 μL, DNA template (10 ng μL-1) 3.0 μL, 멸균된 ultrapure water 15 μL를 넣었다. PCR cycle 조건은 95℃에서 3분간 초기 변성 후 95℃에서 30초 변성, 55℃에서 30초간 primer 결합, 72℃에서 1분간 합성 과정 을 40회 반복하여 증폭하였으며, 반복 완료 후 최종 합성은 72℃에서 5분간 진행하였다. 증폭된 샘플은 1.5% 아가로즈 젤을 이용하여 확인 후 증폭된 부분을 잘라내었으며, PCR gel purification Kit (Solgent, Korea)를 이용해 정제하는 과 정을 진행하였고, Bioneer사의 ABI3730xl DNA Analyzer 플 랫폼 (Macrogen, Korea)으로 Sequencing하여 염기서열을 분석하였다.

    5. 데이터 분석

    남해와 서해에서 채집된 말쥐치의 다중배열 (multiple alignment) 분석은 CLUSTALW2 software (http://www.ebi. ac.uk/Tools/msa/clustalw2)를 이용하였으며, 다중배열은 GeneDoc Program (version 2.7.000)으로 나타내었다. 말 쥐치와 유사종 (T. septentrionalis) COI 유전자를 비교하기 위해 NCBI Gen Bank Database의 상동 서열 (homologous sequences) 을 이용하여 계통유전학적 분석 (phylogenetic analysis)을 하였다. 계통유전학적 분석 (phylogenetic analysis) 은 Mega X software (version 10.2.4)를 이용하여 Maximum Composite Likelihood method를 통해 Neighbor joining tree (1,000 bootstrap)로 분석하였다.

    결 과

    1. 말쥐치 형태

    본 연구에서 채집 즉시 촬영한 개체 (Fig. 1B)는 회갈색 바 탕에 몸 전체에 흑갈색 무늬가 불규칙하게 산재해 있었으며, 지느러미는 청록빛을 띠었다. 하지만, 냉동보관하여 실험실 로 옮겼을 때 흑갈색 무늬가 흐릿해지며 체색이 변하는 경 향이 관찰되었다 (Fig. 1C). 말쥐치는 등지느러미가 눈 뒤쪽 에 제1 등지느러미가 있으며 일정한 간격을 두고 제2 등지 느러미가 있다. 제1 등지느러미는 2개로 이루어졌는데, 송곳 과 같이 발달된 첫 번째 가시와 그 뒤를 지지해주는 작은 가 시가 존재한다. 제2 등지느러미는 기조로 이루어져 있으며, 본 연구에서 채집된 개체의 등지느러미 기조 수는 35~39개 로 계수되었다. 등지느러미 기조 수의 차이는 끝 부분에서 계 수적 차이를 보였다 (Fig. 1E, F). 기존에 보고된 유사종 (T. septentrionalis)의 형태도 말쥐치와 비슷하게 회갈색 바탕에 불규칙한 흑갈색 무늬가 나타나고 등지러미 기조 수도 38개 로 보고되었다 (Bian et al., 2020; Fig. 1A, D).

    말쥐치와 유사종 (T. septentrionalis)의 계수형질을 비교하 기 위해 국내외 문헌들을 조사한 결과, 말쥐치의 계수형질에 서 등지느러미 기조 수를 35~38개로 기재하였으며 (Kim et al., 2005), 다른 문헌에서도 말쥐치의 등지느러미 기조 수를 35~40개까지 보고하였다 (Masuda et al., 1984;Shen et al., 1993;Nakabo, 2000). 또한, 유사종 (T. septentrionalis)의 등 지느러미 기조 수는 34~39개로 보고하였다 (Zheng, 1962;Zhu et al., 1963;Masuda et al., 1984;Xu and Ni, 1984;Su and Li, 2002). 본 연구에서 채집된 말쥐치의 등지느러미 기 조 수는 35~39개로 계수되었으며, 1개체 (TMO2103-29)를 제외한 모든 개체들이 38개 이하로 계수되었다.

    본 연구에서 채집된 서남해안 말쥐치 전장은 165.2~335.8 (mean 240.3±50.3) mm였다. 전장에 대한 체장비는 86.9± 2.4%였으며, 두장비는 23.8±0.6%, 체고비는 30.0±2.7% 로 나타났으며, 유사종 (T. septentrionalis)의 계수 및 계측 형 질, 전장에 대한 체장, 체고, 두장비는 차이가 없었다. 하지 만, Pre-pelvic length (말쥐치: 26.4±0.6; T. septentrionalis: 42.2)와 Pre-pectoral length (말쥐치: 36.2±10.1; T. septentrionalis: 25.1)에서 차이가 나타났다 (Frese and Pauly, 2021; Table 1).

    말쥐치의 내부 골격은 두개골 (Cranium), 견대부 (Shoulder girdle), 새개부 (Operculum region), 악부 (Jaw bone), 설궁 부 (Hyoid arch), 구개익상부 (Palato-pterygoid region) 및 척 추골 (Vertebrae)을 스케치하였다 (Fig. 2). 두개골 (Fig. 2A)은 사골과 부설골이 앞으로 길게 발달되어 있어 말 머리의 형태 를 띠고 있었으며, 제1 등지느러미 가시와 기저담기골 사이 에 제2 등지느러미 가시가 위치해 있었다. 견대부 (Fig. 2B) 는 쇄골, 상쇄골, 후쇄골, 견갑골, 오혜골로 구성되어 있으며, 새개부 (Fig. 2C)는 전새개골, 간새개골, 주새개골, 하새개골 로 이루어졌다. 악골 (Fig. 2D)은 전상악골과 주성악골, 치골, 관절골 및 각골로 이루어져있으며, 치골 안쪽에 관절골과 각 골이 하나의 골격으로 접해 있었다. 또한, 전상악골에는 바깥 쪽에 3개의 이빨과 안쪽에 2개의 이빨이 있었고, 치골에도 3 개의 이빨이 있었다. 설궁부 (Fig. 2E)에는 간설골, 상설골, 각 설골, 미설골, 하설골 및 상설골이 접해있으며, 새조골은 6개 로 구성되어 있다. 구개익상부 (Fig. 2F)는 각골, 방골, 외익상 골, 중익골, 후익상골로 구성되어 있고 척추골 (Fig. 2G)은 18 (6+12)개로 이루어져 있었다.

    2. 말쥐치와 유사종 (T. septentrionalis)의 계통유전학적 분석

    본 연구에서 서남해안에서 채집된 말쥐치의 mtDNA내 599 bp COI 유전자 염기서열을 NCBI Genbank에 보고된 유 사종 (T. septentrionalis) 4개체와 다중배열 비교 및 계통유전 학적 분석하였다. 그 결과, 서남해 말쥐치의 COI 염기서열 변 이는 7종류로 나타났으나 전체적인 상동성이 98.8% 이상으 로 유사성이 높았다 (Fig. 3). 또한, NCBI에 보고된 유사종 (T. septentrionalis) 4개체 중 2개체는 (JN813099, MW485059) 서남해 말쥐치와 99% 염기서열 상동성을 나타내어 같은 종 으로 나타났으나, 나머지 2개체는 (EF607583, KP267619) 는 말쥐치와 95% 염기서열 상동성을 나타냈다. 나아가 서남 해안 말쥐치, Genbank에 등록된 말쥐치 (6 개체), 유사종 (T. septentrionalis, 4개체)들의 COI 시퀀스를 바탕으로 계통유 전학적 연관관계를 분석하였다 (Fig. 4). 말쥐치와 유사종 (T. septentrionalis)은 계통유전학적으로 크게 6개의 계통 분기 (clade tree)를 형성하였으며, 그중 본 연구에서 채집한 말쥐 치는 각기 다른 5개의 clade에 포함되어 말쥐치 내 유전 변 이가 다양하게 나타나는 것을 확인하였다. 또한, 유사종 (T. septentrionalis)으로 보고된 2개체는 말쥐치 그룹 내에 속해 있어 유전적으로 말쥐치로 분류되었다.

    나아가 복어목 어류에 속하는 16종 (황해흰점복, Takifugu alboplumbeus; 흰점꺼끌복, Arothron hispidus; 가시복, Diodon holocanthus; 쐐기개복치, Ranzania laevis, 뿔복, Lactoria cornuta; 거북복, Ostracion immaculatum; 황록쥐치, Pseudobalistes flavimarginatus; 가는꼬리쥐치, Abalistes stellaris; 파랑쥐치, Balistoides conspicillum; 가시쥐치, Chaetodermis penicilligerus; 객주리, Aluterus monoceros; 날개쥐치, Aluterus scriptus; 남별쥐치, Thamnaconus tessellatus, 별쥐치, T. hypargyreus; 말쥐치, T. modestus; T. septentrionalis) 어류의 COI 시퀀스로 계통유전학적 관계를 분 석하였다 (Fig. 5). 본 연구에서 채집한 말쥐치와 NCBI에 등 록된 말쥐치는 계통유전학적으로 가까운 것으로 확인되었다. 하지만 NCBI에 등록된 유사종 (T. septentrionalis) COI 시 퀀스 중 2개의 시퀀스 (EF607583, MK777832)는 별쥐치 (T. hypargyreus)와 남별쥐치 (T. tessellatus)와 계통유전학적으 로 근연관계가 가까운 것으로 나타났으며, 나머지 2개의 시 퀀스 (JN813099, MW485059)는 계통유전학적 근연관계를 기반으로 말쥐치와 분류적으로 같은 종으로 확인된다.

    고 찰

    본 연구는 서남해안 말쥐치의 외부형태와 골격을 기초 자료로 제시하며, mtDNA를 바탕으로 말쥐치와 유사종 (T. septentrionalis)의 계통유전학적 분석을 통한 진화적 연관 관계를 확인하였다. 또한, 말쥐치와 형태적으로 매우 유사 한 T. septentrionalis의 보고된 연구 자료를 바탕으로 형태 적 특징과 유전적 비교를 통해 종 분류를 진행하였다. 말쥐 치는 긴 타원형으로 체형이 측편되어 있으며 색 변이가 심 하고 청록색 지느러미와 회갈색 바탕에 흑갈색 무늬가 불규 칙하게 흩어져 있는 것이 특징이다 (Kim et al., 2005). 서해 와 남해에서 채집된 말쥐치의 외부 형태는 Kim et al. (2005) 에 보고된 특징과 같았으며, 일본어류 검색도감 (Nakabo, 2000)을 통한 분류도 말쥐치로 확인되었다. 또한, 시료의 내 부 골격의 형태도 기존 연구 (Kimura, 2010;Yu, 2018)와 유사하게 나타났다. T. septentrionalis로 보고된 유사종 (T. septentrionalis)도 청록색 지느러미와 흑갈색 무늬가 불규 칙하게 산재해 있었으며 (Fig. 1A, Bian et al., 2020), 본 연 구에서 채집한 말쥐치 (Fig. 1B)와 체고와 체색의 차이 외에 유사한 특징을 보였다. 하지만, 체고의 경우, 말쥐치의 암수 를 부분하는 형질 중 하나로 암컷은 수컷보다 체고가 높은 특징을 가지고 있으며 (Lee et al., 2000b), 체색의 변화가 다 양하여 체고와 체색의 차이로 종을 분류하는 것은 적합하지 않는 것으로 판단된다.

    국외에 보고된 유사종 (T. septentrionalis)의 경우, Masuda et al. (1984)에서는 외부 형태에 대한 사진은 사후 시간 이 지난 상태로 체색에 변이가 심하여 명확한 구분이 어려 웠으며, Nakabo (2000)에서는 말쥐치와 동일 어종으로 기 록하였다. 대만에서는 말쥐치와 유사종이 형태적 차이가 거의 없으며 체색으로 분류한다고 보고하였다. 유사종 (T. septentrionalis)에 대하여 가장 많은 연구 (Zheng, 1962;Zhu et al., 1963;Xu and Ni, 1984;Su and Li, 2002)가 진 행된 중국에서도 명확한 외부 형태의 그림이 없을 뿐만 아 니라 (Fenghui et al., 2019), 계수 및 계측 형질을 포함한 외 부 형태 특징도 Bian et al. (2020)의 연구와 차이가 있어 분 류의 기준이 될만한 자료가 부족하다. 특히, 중국에서도 체 색을 이용하여 말쥐치와 유사종 (T. septentrionalis)을 분류 하지만, 체색의 경우 네 개의 문헌에서 사후 시간 경과에 따 라 청록색, 회색 및 짙은 갈색으로 모두 다르게 나타나 체색 변화의 메커니즘 연구에 대한 필요성을 제시되기도 하였다 (Fenghui et al., 2019).

    어류의 계측 형질을 나타낼 때 계측하고자 하는 시작점 과 끝점의 명확한 기준을 바탕으로 관찰되어야 하는데, T. septentrionalis의 계측 형질 결과는 단순히 측정 부위만 나 타냈을 뿐 정확한 기준과 상세한 측정 부위를 표기하지 않 아 자세한 비교가 쉽지않다. 체색, 계수 및 계측 형질과 같은 외부 형태를 기준으로 비교한 결과 서남해안 말쥐치와 유사 종 (T. septentrionalis) 간의 분류를 형태정보만으로 구분하 는 데는 어려움이 있는 것으로 확인되었다. 이러한 문제점으 로 인해 형태적으로 차이가 나타나는 부분에 대해서도 분류 상 다른 종이라고 명확히 단정지을 수 없었으며, 이에 말쥐 치와 유사종 (T. septentrionalis)처럼 외부형태가 유사한 경 우 유전학적 종 분류를 병행할 필요성이 있다.

    본 연구에서 서해와 남해에서 채집한 말쥐치 mtDNA에서 COI 염기서열 변이가 7종류로 나타났으며 서남해안 말쥐치 와 Genbank에 등록된 말쥐치 및 유사종 (T. septentrionalis) 간의 계통유전학적 분석에서도 6개의 clade가 나타나 본 연 구에서 채집된 서남해안 말쥐치의 유전적 다양성을 확인하 였다. 이러한 결과는 말쥐치의 mtDNA 유전적 다양성의 다 른 연구에서도 유사한 결과를 보였다 (Gwak and Roy, 2021;Yang et al., 2019). 특히, Gwak and Roy (2021) 연구에서는 일본과 국내에서 채집된 말쥐치의 clade가 지역적으로 나 누어졌으나, 본 연구의 서남해에서는 지역적 차이와 연관 성이 없었으며, 지역적 차이에 따른 변이의 다양성을 확인 하기 위해서는 충분한 개체수를 대상으로 하는 연구가 필 요할 것으로 생각된다. 해양 어류는 동일 어종임에도 불구 하고 mtDNA 분석에서 두 개의 clade가 흔히 발생하기도 하 며 (Cheng et al., 2018), 이는 시료 크기, 서식처 및 유전적 부동 (genetic drift)에 의한 가능성이 있는 것으로 알려져 있 다 (Yang et al., 2019;Gwak, 2021).

    상위 분류군에 속하는 복어목의 계통유전학적 연구에 서는 말쥐치와 유사종 (T. septentrionalis)으로 등록된 4개 체의 종 분류가 다르게 나타났다. 염기서열 상동성이 99% 로 말쥐치로 분류되는 유사종 (T. septentrionalis) 시퀀스 (JN813099, MW485059)와 말쥐치보다 별쥐치와 진화적 근연관계가 가까운 clade로 나타나는 시퀀스 (EF607583, KP267619) 결과가 나타났다. 이러한 결과는 형태적 특징만 으로 등록된 종 분류의 부정확성과 유전적 근연관계 분석 의 병행 연구가 필요함을 시사한다. 특히, 형태적으로 유사 하여 분류가 어려운 어류의 분류군을 DNA를 활용하여 계 통분류학적 위치에 대한 연구가 꾸준히 진행되어왔다. 납 자루아과 (Achilognathinae) 어류는 분류학자에 따라 분류 기준이 다르며, 국내외에서 분류학적 논란이 지속되었으 나, DNA를 활용하여 종 간 유연관계를 파악하고 집단 변 이를 파악하였다 (Yun, 2009). 또한, 말쥐치와 같은 복어목 에 속하는 참복아목 (Tetraodontoidei) 어류도 형태가 특이 하고 다양하여 종의 구분이 어려우며, 유사종이 많은 어류 로, 이 분류군도 DNA를 활용하여 분류군 내 유연관계를 검 토하고 계통유전학적 연구를 진행하였다 (Baek, 2017). 이외 에 누치속 (Hemibarbus), 쉬리속 (Coreoleuciscus), 전갱이과 (Carangidae) 어류처럼 같은 분류군 내에 있어 형태 분류에 어려움이 있는 종들에 DNA를 활용한 유전적 종동정의 필 요함이 보고되었다 (Lim, 2005;Kim, 2012;Song, 2015).

    이러한 연구 결과들은 국내 서남해안 말쥐치의 유전적 다 양성 확인뿐 아니라 보고된 유사종 (T. septentrionalis)의 종 분류에 있어 외부 형태와 내부 골격 및 유전학적 정보를 제 공함으로 나아가 말쥐치와 유사종 (T. septentrionalis)의 분 류학적 기준을 확립하는 데 주요한 기반 정보가 될 것이다.

    적 요

    말쥐치는 북서태평양 해역에 분포하는 군집성 어류로 수 산식품으로 이용되는 경제적 가치가 높은 어종이다. 본 연 구에서는 서남해에 서식하는 국내산 말쥐치 (Thamnaconus modestus)와 기존에 보고된 유사종 (Thamnaconus septentrionalis) 과의 형태적-유전적 특징을 비교-분석하였다. 이 를 위해 서남해에서 채집한 말쥐치의 외부 형태와 골격 을 관찰하고, 미토콘드리아 DNA의 cytochrome c oxidase subunit I (COI) 유전자 염기서열을 비교하여 유사종 (T. septentrionalis)과의 계통진화적 연관관계를 분석하였다. 서 남해안 말쥐치의 외부 형태는 회갈색 바탕에 몸 전체에 흑 갈색 무늬가 불규칙하게 산재된 패턴을 가지며 청록빛의 지 느러미가 관찰되었다. 채집한 말쥐치에서 추출한 미토콘드 리아DNA의 COI 유전자 분석결과 7종류의 염기서열 변이 가 나타났으나 상동성이 전체적으로 98.8% 이상으로 유사 성이 높게 나타났다. 또한 형태적으로 말쥐치 유사종인 T. septentrionalis COI 염기서열 비교와 계통유전학적 분석 결 과, 보고된 시퀀스 중 상동성이 99%로 유전적으로 말쥐치로 보여지는 두 종 (JN813099, MW485059)과 상동성 95%로 유사종으로 보이는 두 종 (EF607583, KP267619)이 확인되 었다. 말쥐치와 유사종은 계통유전적 분석결과 말쥐치와 유 사종의 차이를 확인하였으나 형태적 특징으로 종 분류는 어 려운 상태이다. 따라서 본 연구는 말쥐치의 외부 형태와 내 부 골격 및 계통유전학적 정보를 제공함으로 말쥐치와 유사 종 (T. septentrionalis)의 분류학적 재검토를 진행하는 데 주 요한 정보가 될 것이다.

    저자정보

    유태식 (전남대학교 박사과정생), 박기연 (전남대 학교 연구교수), 한경호 (전남대학교 교수), 곽인실 (전남대학 교 교수)

    저자기여도

    개념설정: 유태식 & 한경호 & 곽인실, 방법론: 유태식 & 박기연, 분석: 유태식 & 박기연, 자료제공: 유태식 & 박기연 & 한경호, 자료관리: 유태식 & 한경호 & 곽인실, 원고 초안작성: 유태식 & 박기연, 원고 교정: 유태식 & 박기 연 & 곽인실, 원고 편집 및 검토: 박기연 & 곽인실 & 한경호, 과제관리: 곽인실, 연구비 수주: 곽인실. 모든 저자는 논문의 결과에 동의하였고, 출판될 최종본을 검토하고 동의하였습 니다.

    이해관계

    이 논문에는 이해관계 충돌의 여지가 없음.

    연구비

    이 논문은 한국연구재단 중점연구사업의 지원을 받 아 수행된 연구임 [NRF-2018-R1A6A1A-03024314].

    Figure

    KSL-54-3-229_F1.gif

    Characteristics of dorsal fin rays and external view of Thamnaconus modestus. (A) External view of T. septentironalis (Bian et al., 2020), (B) External view of T. modestus (immediately after catching), (C) External view of T. modestus (after storage in deep freezer), (D) Dorsal fin rays of T. septentrionalis (Bian et al., 2020), (E) Dorsal fin rays of T. modestus (Counts: 38), (F) Dorsal fin rays of T. modestus (Counts: 39).

    KSL-54-3-229_F2.gif

    Dissected skeletal elements of Thamnaconus modestus (240.1 mm standard length). (A) Cranium, (B) Shoulder girdle, (C) Operculum region, (D) Jaw bone, (E) Hyoid arch, (F) Palato-pterygoid region, (G) Vertebrae. E: Ethmoid; F: Frontal; PF: Prefrontal; PS: Parasphenoid; BP: Basal pterygiophore; 1st DS: 1st dorsal spine; CL: Cleithrum; SCL: Supracleithrum; PCL: Postcleithrum; CC: Coracoid; SC: Scapula; AC: Actinosts; PV: Pelvic girdle; POP: Preoperculum; OP: Operculum; SOP: Suboperculum; IOP: Interoperculum; M: Maxillary; PM: Premaxillary; D: Dentary; DH: Dorsal hypohyal; VH: Ventral hypohyal; CH: Ceratohyal; EH: Epihyal; IH: Interhyal; BR: Branchiostegal rays; UR: Urohyal; PA: Palatine; Q: Quadrate; EC: Ectopterygoid; ME: Mesopterygoid; MP: Metapterygoid; SY: Symplectic; HY: Hyomandibular. Scale bars indicate 10 mm.

    KSL-54-3-229_F3.gif

    Multiple alignment of COI sequences of Thamnaconus modestus and T. septentrionalis. Sequences of T. septentrionalis from NCBI (JN813099, MW485059, EF607583, and KP267619).

    KSL-54-3-229_F4.gif

    Phylogenetic tree of COI sequences in Thamnaconus modestus and T. septentrionalis constructed by neighbor-joining analysis (bootstrap value 1000). The numbers at the nodes are the percentage bootstrap values. The blue letter present T. modestus individuals in the study. The black letter present T. modestus individuals from Genbank. The red letter present T. septentrionalis individuals from Genbank.

    KSL-54-3-229_F5.gif

    Phylogenetic tree of the COI sequences in 16 species of Tetraodontiformes constructed by neighbor-joining analysis (bootstrap value 1000). The numbers at the nodes are the percentage bootstrap values. The blue letter present T. modestus individuals in the study. The red letter present T. septentrionalis individuals from Genbank.

    Table

    Comparison of meristic and morphometric characters between Thamnaconus modestus and T. septentrionalis.

    Reference

    1. An, H.S. , J.W. Lee, J.Y. Park and H.T. Jung.2013. Genetic structure of the Korean black scraper Thamnaconus modestus inferred from microsatellite marker analysis. Molecular Biology Reports 40: 3445-3456.
    2. Baeck, G.W. , J.M. Park, J.M. Jeong, S.J. Ye and Y.S. An.2012. Feeding habits of black scraper, Thamnaconus modestus in the coastal waters of Geomun-do, Korea. Korean Journal of Ichthyology 24: 272-277.
    3. Baek, J.I. 2017. Taxonomy and molecular phylogeny of the Tetraodontoidei (Teleostei: Tetraodontiformes). Ph.D. Thesis, Chonnam National University.
    4. Berry, F.H. and L.E. Vogele.1961. Filefishes (Monacanthidae) of the western north Atlantic. Fishery Bulletin. Fish and Wildlife Service, Washington, 61: 61-109.
    5. Bian, L. , F. Li, J. Ge, P. Wang, Q. Chang, S. Zheng, J. Li, C. Liu, K. Liu, X. Liu, X. Li, H. Chen, S. Chen, C. Shao and Z. Liu.2020. Chromosome-level genome assembly of the greenfin horse-faced filefish (Thamnaconus septentrionalis) using Oxford Nanopore PromethlON sequencing and Hi-C technology. Molecular Ecology Resources 20: 1069- 1079.
    6. Cheng, J. , Z. Han, N. Song, T. Gao, T. Yanagimoto and C.A. Strussmann.2018. Effects of Pleistocene glaciation on the phylogeographic and demographic histories of chub mackerel Scomber japonicus in the north-western Pacific. Marine and Freshwater Research 69: 514-524.
    7. Choi, J.H. , B.S. Jeon, J.W. Kim, J.H. Lee, Y.J. Im and H.W. Lee.2020. Maturation and spawning of the filefish Thamnaconus modestus in coastal waters of Korea. Korean Journal of Fisheries and Aquatic Sciences 53: 27-35.
    8. Coast, W.J.E.M. 2012. The caudal skeleton of extant and fossil cyprinodontiform fishes (Teleostei: Atherinomorpha): comparative morphology and delimitation of phylogenetic characters. Vertebrate Zoology 62: 161-180.
    9. de Lima, L.C.B. , P.A. Martinez and W.F. Molina.2011. Cytogenetic characterization of three Balistoidea fish species from the Atlantic with inferences on chromosomal evolution in the families Monacanthidae and Balistidae. Comparative Cytogenetics 5: 61-69.
    10. Fenghui, L. , L. Kun, W. Pengfei, B. Li, C. Siqing, C. Qing, G. Jianlong and Z. Liqing.2019. Morphological structure and karyotype of Thamnaconus septentrionalis. South China Fisheries Science 15: 104-112.
    11. Froese, R. and D. Pauly.2021. Fishbase. World Wide Web electronic publication. https://www.fishbase.org. version (02/2021).
    12. Gilby, B.L. , R.A. Mari, E.G. Bell, E.W. Crawford, D. Jun, B.I. Lederer, I.R. Tibbetts and D.D. Burfeind.2014. Colour change in a filefish (Monacanthus chinensis) faced with the challenge of changing backgrouds. Environmental Biology of Fishes 98: 2021-2029.
    13. Gwak, W.S. and A. Roy.2021. Genetic diversity and population genetic structure of Korean black scraper Thamnaconus modestus in Korea and Japan based on the mtDNA marker. Ocean Science Journal 56: 266-274.
    14. Han, K.H. , S.G. Byeon, S.H. Kim, J. Lee, T.S. Yu and S.H. Lee.2018. Morphological development of the larvae and juveniles of Thamnaconus modestus. Bulletin of the Fisheries Science Institute Chonnam National University 26: 55-59.
    15. Holcroft, N.I. 2005. A molecular analysis of the interrelationships of tetraodontiform fishes (Acanthomorpha: Tetraodontiformes). Molecular Phylogenetics and Evolution 34: 525- 544.
    16. Hutchins, J.B. 1977. Descriptions of three new genera and eight new species of Monacanthid fishes from Australia. Records of the Western Austrailan Museum 5: 3-58.
    17. Jang, M.H. , J.D. Yoon, B.S. Chae and G.J. Joo.2006. Molecular phylogeny of Pungitius kaibarae from mitochondrial DNA sequences in selected streams flowing into the East Sea. Korean Journal of Ecology and Enviorment 39: 265- 270.
    18. Kim, H.R. , J.H. Choi and W.G. Park.2013. Vertical distribution and feeding ecology of the black scraper, Thamnaconus modestus, in the Southern Sea of Korea. Turkish Journal of Fisheries and Aquatic Sciences 13: 249-259.
    19. Kim, I.S. , Y. Choi, C.L. Lee, Y.J. Lee, B.J. Kim and J.H. Kim.2005. Illustrated book of Korean fishes. Kyohak Publishing, Seoul.
    20. Kim, J.K. , J.Y. Park and Y.U. Kim.2003. Sequence variation in the mitochondrial cytochrome b genes in three mullets (Mugilidae, Pisces). Korean Journal of Ichthyology 15: 232-240.
    21. Kim, J.S. 2012. Molecular phylogenetic relationships and identification of Korean carangid fishes. Master Thesis, Jeju National University.
    22. Kim, Y.U. 1989. Introduction of ichthyology. Taehwa Publishing, Busan, Korea.
    23. Kimura, S. 2010. New atlas of fish anatomy. Midori Shobo Publishing, Tokyo.
    24. Koh, B.S. and C.B. Song.2004. Molecular phylogeny of Syngnathiformes fishes inferred from mitochondrial cytochrome b DNA sequences. Korean Journal of Fisheries and Aquatic Science 37: 405-413.
    25. Koh, J.R. and Y.C. Park.2007. Species identification and molecular phylogenetic position of Korean damselfishes (Pomacentridae: Chrominae) based on DNA bioinformation. Korean Journal of Ichthyology 19: 274-285.
    26. Lee, J. , C.S. Kim, I.Y. Lee, H.J. Oh, J.H. Kim and S.Y. Kim.2012. Identification of Korean Poaceae weeds based on DNA sequences. Weed & Turfgrass Science 4: 26-34.
    27. Lee, S.J. , Y.B. Go and Y.C. Choi.2000a. Egg development and morphological changes of larvae of the file fish, Thamnaconus modestus. Korean Journal of Ichthyology 12: 208- 214.
    28. Lee, S.J. , Y.B. Go, Y.D. Lee, J.H. Jung and C.H. Han.2000b. Annual reproductive cycle of the file fish Thamnaconus modestus, on the southern coast of Cheju island. Korean Journal of Ichthyology 12: 71-84.
    29. Lim, Y.H. 2005. The complete nucleotide sequence and phylogenetic analysis of the mitochondrial genome in the three species of genus Hemibarbus and Coreoleuciscus splendidus. Master Thesis, Soonchunhyang University.
    30. Masuda, H. , K. Amaoka, C. Araga, T. Uyeno and T. Yoshino.1984. The fishes of the Japanese archipelago. Oxford University Press, Tokyo.
    31. Matsuura, K. 2015. Taxonomy and systematics of Tetraodontiform fishes: a review focusing primarily on progress in the period from 1980 to 2014. Ichthyological Research 62: 72-113.
    32. Nakabo, T. 2000. Fishes of Japan with pictorial keys to the species second edition. Tokai University Press, Tokyo.
    33. Nam, K.M. , J.T. Yoo, J.W. Kim, J.H. Park and G.W. Baeck.2018. Maturation and spawning of female black scraper, Thamnaconus modestus in the coastal waters off middle East sea, Korea. Journal of Korean Society of Fisheries and Ocean Technology 54: 89-95.
    34. Ni, Y. and H.L. Wu.2006. Fishes of Jiangsu Province. China Agriculture Press 2: 634-701.
    35. Okaichi, T. , H. Kai and Y. Hashimoto.1958. A rapid color change in the filefish. Bulletin of the Japanese Society of Scientific Fisheries 24: 389-393.
    36. Park, C.S. and H.Y. Lee.1991. Systematic study on the fishes of family Cobitidae (Pisces: Cypriniformes): Extensive variation in mitochondrial DNA among geographic populations of Nemacheilus toni. Korean Journal of Ichthyology 3: 140-147.
    37. Park, K. and W.O. Lee and I.S. Kwak.2019. Molecular phylogenetic study of the barbell steed (Hemibarbus labeo) in Seomjin River of Korea. Korean Journal of Ecology and Environment 52: 221-230.
    38. Shen, S.-C. , S.-C. Lee, K.-T. Shao, H.-K. , Mok, C.-W. Chen and C.-T. Chen.1993. Fishes of Taiwan. Department of Zoology, National Taiwan University, Taipei.
    39. Song, H.Y. 2015. Taxonomy and population genetics in genus Coreoleuciscus (Teleostei: Cypriniformes). Ph. D. Thesis, Soonchunhyang University.
    40. Song, Y.S. , T.W. Ban and J.K. Kim.2015. Molecular phylogeny and taxonomic review of the family Liparidae (Scorpaenoidei) from Korea. Korean Journal of Ichthyology 27: 165-182.
    41. Strauss, R.E. and C.E. Bond.1990. Taxonomic methods: Morphology, p. 109-140. In: Methods for fish Biology (Schreck, C.B. and P.B. Moyle, eds.). Bethesda, M.D.: American Fisheries Society.
    42. Su, J.X. and C.S. Li.2002. Fauna sinica: Osteichthyes (Tetraodontiformes, Pegasiformes, Gobiesociformes and Lophiiformes). Science Press, Beijing.
    43. Triantafyllidis, A. , D. Bobori, C. Koliamitra, E. Gbandi, M. Mpanti and O. Petriki.2011. DNA barcoding analysis of fish species diversity in four north Greek lakes. Mitochondrial DNA 22: 37-42.
    44. Tyler, J.C. 1980. Osteology, phylogeny, and higher classification of the fishes of the order Plectognathi (Tetraodontiformes). NOAA Technical Report NMFS Circular.
    45. Ward, R.D. , T.S. Zemlak, B.H. Innes, P.R. Last and P.D. Hebert.2005. DNA barcoding Australia’s fish species. Philosophical Transactions of the Royal Society B: Biological Sciences 360: 1847-1857.
    46. Xu, Y.C. and Y. Ni.1984. Fishes of Fujian Province. Fujian Science & Technology Publishing House, Fuzhou.
    47. Yamada, U. , S. Shirai, T. Irie, M. Tokimura, S. Deng, Y. Zheng, C. Li, Y.U. Kim and Y.S. Kim.1995. Names and illustrations of fishes from the East China Sea and the Yellow Sea. Overseas Fishery Cooperation Foundation of Japan, Tokyo.
    48. Yang, T. , Z. Wang, Y. Liu and T. Gao.2019. Population genetics and molecular phylogeography of Thamnaconus modestus (Tetraodontiformes, Monacanthidae) in Northwestern Pacific inferred from variation of the mtDNA control region. Aquatic Living Resources 32: 1-9.
    49. Yu, T.S. 2018. The phylogenetic study of Rudarius ercodes, Stephanolepis cirrhifer, and Thamnaconus modestus. Master thesis, Chonnam National University.
    50. Yun, Y.E. 2009. Molecular phylogenetics and population genetics of Korean bitterlings, subfamily Achilognathinae. Master Thesis, Soonchunhyang University.
    51. Zheng, B.S. 1962. The fishes of the South China Sea. Science Press, Beijing.
    52. Zhu, Y.D. , C.L. Zhang and Q.T. Cheng.1963. The fishes of the East China Sea. Science Press, Beijing.