Journal Search Engine
Search Advanced Search Adode Reader(link)
Download PDF Export Citaion korean bibliography PMC previewer
ISSN : 2288-1115(Print)
ISSN : 2288-1123(Online)
Korean Journal of Ecology and Environment Vol.54 No.3 pp.156-169
DOI : https://doi.org/10.11614/KSL.2021.54.3.156

Review and Suggestions for Applying DNA Sequencing to Zooplankton Researches: from Taxonomic Approaches to Biological Interaction Analysis

Hye-Ji Oh*, Yeon-Ji Chae, Yerim Choi, Doyeong Ku, Yu-Ji Heo1, Ihn-Sil Kwak2, Hyunbin Jo3, Young-Seuk Park4, Kwang-Hyeon Chang*, Hyun-Woo Kim1*
Department of Environmental Science and Engineering, Kyung Hee University, Yongin 17104, Republic of Korea
1Department of Environmental Education, Sunchon National University, Suncheon 57922, Republic of Korea
2Fisheries Science Institute, Chonnam National University, Yeosu 59626, Republic of Korea
3Institute for Environment and Energy, Pusan National University, Busan 46241, Republic of Korea
4Department of Biology, Kyung Hee University, Seoul 02447, Republic of Korea
* Corresponding author: Tel: +82-31-201-3399 E-mail: ohg2090@naver.com Tel: +82-31-201-2977 E-mail: chang38@khu.ac.kr Tel: +82-61-750-3384 E-mail: hwkim@sunchon.ac.kr
15/09/2021 20/09/2021 23/09/2021

Abstract


Traditional morphological identification difficulties, such as phenotypic plasticity, misidentification of cryptic species, and larval stage species, can be compensated for by using DNA analysis techniques, such as DNA barcoding, in surveying zooplankton populations, including species identification. Recently, the rapid development of DNA sequencing techniques has allowed DNA-based community analysis not only for zooplankton assemblages in various aquatic ecosystems but also for the gut contents of zooplankton that are limited by conventional methods such as visual and microscopic identification. Therefore, the application of DNA sequencing can help understand biological interactions through the analysis of zooplankton food sources. The present paper introduces the major DNA-based approaches in zooplankton research topics, including taxonomic approaches by DNA barcoding, community-level approaches by metabarcoding, and gut content analyses, summarizes the analysis methods, and finally suggests the methodological topics that need to be considered for future applications.



동물플랑크톤 연구에 있어 DNA 분석 기법의 활용 방법과 과제: 개체 동정에서 군집 분석, 생물학적 상호작용 분석까지

오 혜지*, 채 연지, 최 예림, 구 도영, 허 유지1, 곽 인실2, 조 현빈3, 박 영석4, 장 광현*, 김 현우1*
경희대학교 환경학및환경공학과
1순천대학교 환경교육과
2전남대학교 수 산과학연구소
3부산대학교 환경·에너지연구소
4경희대학교 생물학과

초록


    서 론

    동물플랑크톤은 수생태계 초식먹이망 (grazing food web) 내 중간자적 위치에 존재하여 식물플랑크톤을 섭식하고 저 서성 대형무척추동물 유생 및 어류 치어들의 먹이원으로 소 비되는 과정을 통해 저차 생물군집의 물질·에너지를 고차 생 물군집으로 전달하는 역할을 수행한다. 이들은 생활사가 짧 은 특징이 있어 무생물학적 (abiotic) 및 생물학적 (biotic) 환 경 요인의 직·간접적인 영향에 따라 종 조성, 개체 밀도, 그 에 따른 생산성 등이 빠르게 반응하기 때문에 수생태계 환경 을 평가하는 지표로서 활용 가능하며, 특히 해양생태계에서 는 어족 자원 유지를 위한 먹이원으로서 동물플랑크톤 군집 을 보다 효과적으로 모니터링하기 위해 지속적인 연구가 이 루어지고 있다.

    일반적으로 생물 군집 분석은 분류학적 동정 (taxonomic identification)을 바탕으로 이루어지고 있으나, 육안 관찰 을 통해 동정 가능한 분류학적 특징을 가지는 대형 무척추 동물 또는 어류·양서파충류를 포함하는 척추동물과는 달 리 동물플랑크톤은 작은 개체 크기로 인해 광학 현미경 을 통한 관찰이 필요하다. 많은 유사종과 자매종 (cryptic & sibling species)을 가지는 동물플랑크톤은 세분화된 동정키 (identification key)를 기반으로 분류되며, 유생기를 가지는 요각류 (copepods)의 경우 해당 시기에 형태적 특성이 뚜렷 하게 나타나지 않기 때문에 종을 식별하기 위해서는 상대적 으로 많은 분류학적 전문 지식과 자료를 필요로 한다 (Kim et al., 2021). 또한 동물플랑크톤의 표현형 가소성 (phenotypic plasticity)과 유전적 변이는 연구자의 주관적인 판단을 불가 피하게 하여 때때로 오동정을 유발하는 요인이 될 수 있기 때 문에 보다 정확한 동물플랑크톤 군집 분석을 위한 방법이 모 색되어왔다.

    단순한 형태를 가지는 미생물 (e.g. 박테리아)로부터 시작 된 분자계통학적 연구를 바탕으로 1980년대 말 고안된 DNA (deoxyribonucleic acid) 기반의 종 동정 방법은 현재에 이르 러 크기를 막론한 다양한 생물들의 종간 근연 관계와 같은 분류계통학적 연구 및 특정 종의 분포에 관한 생물지리학적 연구 등에 활발하게 적용되고 있다 (Pace, 1997;Lee et al., 2011;Taberlet et al., 2012). DNA 기반의 종 동정 방법은 개 체로부터의 DNA 추출, DNA 증폭, 서열 분석에 필요한 기본 적인 실험 스킬 (lab skills)만 있다면 비교적 빠르고 객관적인 데이터를 얻을 수 있기 때문에, 크기가 작고 동정이 어려운 동물플랑크톤에 적용할 경우 오동정의 가능성을 줄여 보다 정확한 군집 분석을 가능하게 한다 (Shokralla et al., 2012;Bucklin et al., 2016;Makino et al., 2017;Kim et al., 2021). 뿐만 아니라 개체가 훼손되어 육안으로 동정이 불가능한 경 우, 특히 위 내용물과 같은 섭식 관계에 있어 주요 먹이원을 동정하는 경우 DNA 분석 기법의 적용이 가능하므로, 수생태 계 구성 생물 중 선택적 섭식에 대한 객관적 증거가 비교적 부족한 동물플랑크톤의 먹이망 내 역할과 일차생산자 군집 에 미치는 섭식 영향을 분석하는 데 활용될 수 있다 (Craig et al., 2013;Ho et al., 2017;Oh et al., 2020a).

    따라서 본 논문에서는 과거 수행된 국내외 연구 내용을 바 탕으로 동물플랑크톤 연구에 DNA 분석 기법이 적용된 사례 를 소개하고 연구 목적에 따른 분석방법을 정리하여, 향후 동 물플랑크톤 연구에 DNA 분석 기법을 활용하고자 하는 연구 자들에게 연구 접근성을 높일 수 있도록 방법론적인 기초 지 식을 제공하고자 하였다. 동시에 현재 DNA 분석 기법의 적 용 한계점과 연구 목적에 따라 고려해야 할 과제 등을 제시 하여 보다 적절하게 유전자 기법을 적용하고 정확한 연구 결 과를 도출하는 데 도움이 되고자 하였다.

    DNA 바코딩 (DNA barcoding)을 이용한 동물플랑크톤 연구

    DNA 바코딩 (DNA barcoding)은 유전체 DNA (genomic DNA, gDNA) 중 짧고 표준화된 조각 (fragment)을 이용하여 생물종을 식별하는 분석 기법으로, gDNA의 특정 영역 내 분 자 상이성 (molecular divergence), 즉 DNA 염기서열의 차이 를 기반으로 조작상 분류 단위 (operational taxonomic unit, OTU)를 제공하기 때문에 전통적인 종 동정 방법의 대안으 로 활용되고 있다 (Hebert et al., 2003;Elías-Gutiérrez et al., 2018). 생태학 분야에서 DNA 바코딩 기법은 넓은 범위의 분 류군으로부터 종을 동정하거나 새로운 종 혹은 미기록종의 발굴, 종분화 (speciation)와 같은 생물분류학적 연구뿐만 아 니라 환경시료로부터 계통분류학적 다양성을 추정하고 지역 에 따라 발생하는 유전적 변이를 비교하는 등 다양한 연구 목 적을 위해 활용되고 있다 (DeSalle and Goldstein, 2019).

    동물플랑크톤의 경우, 전통적인 동정 방법으로 구분이 어 려웠던 유사종 및 자매종의 분류 (e.g. 지각류- Elías-Gutiérrez and Valdez-Moreno, 2008;Quiroz-Vazquez and Elías- Gutiérrez, 2009;Duggan et al., 2012;Maruoka et al., 2018;Conde-Porcuna et al., 2021, 요각류- Montiel- Martínez et al., 2008), 휴면란 및 유생 시기의 종 동정 (e.g. 전분류군-Briski et al., 2011, 요각류-Makino et al., 2013;Park et al., 2018, 지각류 및 요각류-Bryant and Arehart, 2021)을 포함하여 담 수 생태계부터 기수·해양 생태계까지 보다 빠르고 정확한 지 각류, 요각류 및 윤충류의 종 동정을 위한 DNA 바코딩 연구 가 수행되어왔다 (Elías-Gutiérrez et al., 2008;Bucklin et al., 2010a;García-Morales and Elías-Gutiérrez, 2013;Blanco- Bercial et al., 2014;Baek et al., 2016;Makino et al., 2017).

    DNA 바코딩 기법의 분석 과정은 일반적으로 (1) 시료 의 채집 및 보존, (2) 표본으로부터 DNA 추출, (3) PCR (polymerase chain reaction) 증폭, (4) 서열분석 과정으로 나 누어 볼 수 있다 (Fig. 1).

    1. 동물플랑크톤 DNA 바코딩을 위한 시료의 채집 및 보존 방법

    DNA 바코딩에 사용되는 동물플랑크톤 시료는 분석하고 자 하는 대상 개체가 채집될 수 있도록 적절한 망목 (mesh size)과 형태의 동물플랑크톤 네트를 사용하여 채집한다. 일 반적으로 동물플랑크톤 채집 시 윤충류-60 μm, 지각류 및 요 각류-100 μm, 해양 요각류와 같은 대형종-200 μm 망목의 동 물플랑크톤 네트를 사용할 수 있으며, 지각류와 요각류의 경 우, 수직 분포를 고려하여 저층에서 수표면으로의 수직끌 기 (vertical towing)가 채집에 효과적일 수 있다 (Oh et al., 2020b).

    일반적으로 채집한 시료는 가능한 한 빠르게 DNA 바코 드 분석에 사용되어야 하지만, 상황이 여의치 않을 경우 시 간이 지남에 따라 발생하는 DNA 분해 (degradation)를 최소 화하기 위해 시료를 고정 (fixation)하여 보존해야 한다. 시료 를 얼리거나, 사이안화물 (cyanide) 혹은 에탄올 (ethanol)을 첨가하는 방법이 DNA 보존에 친화적인 것으로 알려져 있으 며 (Hajibabaei et al., 2005), 이 중 에탄올 (최종 농도 90% 이 상)을 이용한 시료 고정 방법이 가장 보편적이다. 고정된 시 료는 실험실로 운반되어 현미경 하에서 목표로 하는 동물플 랑크톤 종의 개체를 분류 (sorting), 동일 조건 하에서 DNA 추출 직전까지 개별적인 표본 (specimen) 상태로 분리 보존 한다. 이때, 표본은 열과 빛을 피해 보관해야 하며 산화로 인 한 DNA 분해를 방지하기 위해 주기적으로 고정액을 교체 해주거나 (e.g. 24시간에 한번씩) 완충해줘야 할 필요가 있 다. 한편, 아세트산에틸 (ethyl acetate) 혹은 폼알데하이드 (formaldehyde)의 경우 DNA를 손상시킬 수 있기 때문에 고 정액으로서 사용되기에 부적절하다 (Prendini et al., 2002;Lee et al., 2011).

    2. 동물플랑크톤 표본으로부터 DNA 추출 방법

    동물플랑크톤 표본의 gDNA는 페놀 (phenol) 추출 및 에 탄올 침전법 (Bucklin, 2000), 알칼리 용해법 (alkaline lysis method) (Sambrook et al., 1989)과 그에 기반한 HotShot (hot sodium hydroxide and Tris)법 (Truett et al., 2000; modified by Montero-Pau et al., 2008) 등에 의해 추출 가능하다. 최 근 DNA 추출 키트의 개발로 보다 편리하게 표본으로부터의 gDNA 추출이 가능하게 되었으며, 여러 추출 키트 중 Qiagen 사의 DNeasy Tissue & Blood kit가 주로 사용된다 (Geller et al., 2013;Blanco-Bercial et al., 2014;Baek et al., 2016;Bhavan et al., 2016). 키트 사용 시 일반적으로 제조사의 매뉴 얼에 따라 추출 과정을 수행하며, 필요에 따라 표본을 사전에 균질화시키거나, 키트 내 시약의 용량 조절, 특정 단계를 반복 수행하는 등의 과정을 거쳐 DNA 추출 효율을 높일 수 있다.

    3. 추출한 DNA의 PCR 증폭

    유전체의 특정 영역과 관련된 DNA 단편을 의미하는 분 자 마커 (molecular marker)는 연구 목적 및 대상에 따라 핵, 미토콘드리아, 엽록체 등의 유전체 내의 변이 (e.g. 크 기, 염기서열)를 기반으로 선정된다. 동물플랑크톤을 포함 하는 동물계의 종 동정을 위한 분자 마커로는 미토콘드리아 DNA (mitochondrial DNA; mtDNA)의 COI (Cytochrome c oxidase subunit I) 영역이 보편적으로 사용되고 있다 (Hebert et al., 2003).

    mtDNA는 하나의 세포에 여러 개의 사본 (copy)이 있어 PCR을 통한 증폭이 용이할 뿐만 아니라 핵 유전체 (nuclear DNA; nDNA) 대비 진화 속도가 빠르고 모계 유전으로 종 내 및 종간 구분에 효과적이기 때문에 동물계의 DNA 바코 드 판별에 주로 사용되며, 대부분의 진핵생물에 존재하기 때 문에 동물플랑크톤을 포함하는 무척추동물 및 어류와 같은 수생태계 생물 분류군들의 계통유전학적 위치와 진화적 근 연관계, 분류학적 연구에도 적용되어지고 있다 (Zhu et al., 1994;Hillis et al., 1996;Kang et al., 2010). mtDNA의 다양 한 유전자 영역들 중 단백질 암호 유전자인 COI은 1,500 bp 내외의 길이 중 600 bp 내외만으로도 충분히 동물계 생물종 식별이 가능한 해상도를 보이는 것이 특징으로, 본 영역을 바 탕으로 동물플랑크톤 DNA 바코딩 마커로서 고안된 범용 프 라이머 (universal primer)는 대표적으로 Folmer primers와 Zplank primers가 있다 (Table 1).

    Folmer primers는 무척추동물의 계통 연구를 위해 고안 된 마커로 동물플랑크톤을 포함한 다양한 생물군집의 계통 분류 및 생태학적 연구에 활용되어왔다 (Folmer et al., 1994). Folmer primers를 활용한 동물플랑크톤 DNA 바코딩 연 구는 2000년대 초반부터 활발하게 수행되었으며, 최근까 지도 극지를 포함한 세계 여러 해양-담수생태계 내 요각류 (copepeods), 지각류 (cladocerans) 및 윤충류 (rotifers)의 신 종 연구, 종 식별을 통한 동정 기초 자료 확보 및 그에 따른 다양성·분포 연구에의 활용 등에 계속적으로 사용되고있다 (Elías Gutiérrez et al., 2008;Montiel-Martínez et al., 2008;Quiroz-Vazquez and Elías Gutiérrez, 2009;Bucklin et al., 2010a;García Morales and Elías Gutiérrez, 2013;Bhavan et al., 2016;Bryant and Arehart, 2021). 한편, Folmer primers 는 범용 프라이머 특성상 종에 따라 프라이머가 결합되는 부 위의 서열 변동으로 증폭이 원활하지 않은 경우도 있어 프 라이머의 일부 서열을 수정하거나 특정 프라이머를 대체하 는 등 연구 대상종에 적합한 보완이 요구되기도 한다 - e.g. dgLCO/dgHCO (Meyer et al., 2005); HCO2198 → HCO2607 (ACATAGTGGAAATGTGCTACAACATA) (Bucklin et al., 2010b). 또한 다양한 수체의 동물플랑크톤 DNA 바코딩 연 구에 적용한 결과, 연안·해양 대비 담수 생태계에서 동물플 랑크톤의 COI 영역 증폭의 성공이 가변적인 것으로 나타 나 Prosser et al. (2013)에 의해 Zplank primers가 고안되었 다 (Elías Gutiérrez and Valdez-Moreno, 2008;Jeffery et al., 2011).

    Folmer primers의 결합 부분을 기반으로 하는 Zplank primers는 혼합 염기 (base) - S=G 또는 C, W=A 또는 T, R=A 또는 G로 구성되어 있으며, 프라이머 서열의 5′ 방 향에 뉴클레오타이드 꼬리 (nucleotide tail) - modified M13 sequence (Messing, 1983)의 추가를 통해 최종적으로 Table 1의 tailed Zplank primers의 서열을 갖추게 된다. 이러한 보 완 과정을 거쳐 프라이머 결합 부위의 서열 변동으로 인 한 증폭 문제를 해결함과 동시에 오염 DNA (contaminating DNA)의 동시 증폭 (coamplifying)을 최소화하여 염기서열 분석 (sequencing)의 질을 향상시켜 결과적으로 담수 동물플 랑크톤의 COI 영역 증폭 성공률이 평균적으로 20% 정도 증 가하는 효과를 보였으며 (Prosser et al., 2013), 이를 바탕으 로 담수 동물플랑크톤의 DNA 바코드 레퍼런스 라이브러 리 (reference library) 구축, 다양성 모니터링과 같은 연구에 사용되고 있다 (Elías Gutiérrez et al., 2018;Valdez-Moreno et al., 2021). 하지만 일부 적용 가능성에 대한 검증이 이루 어지지 않은 분류군이 존재하기 때문에 담수 동물플랑크톤 의 경우, Folmer primers와 Zplank primers를 동시에 적용하 여 상호 단점을 보완하는 식으로 연구가 진행되는 추세이다 (Makino et al., 2017;Zhang et al., 2020).

    한편, Table 1의 프라이머를 비롯한 범용 프라이머를 적용 하여 증폭된 특정 유전자 영역 (e.g. COI; ribosomal RNA)의 서열을 바탕으로 종 특이 프라이머 (species-specific primer) 의 고안이 가능하다. 종 특이 프라이머의 적용은 동물플랑 크톤의 하위 군집 또는 속 및 종 수준에서 보다 높은 효율 의 DNA 바코딩 연구를 가능하게 한다 (Fig. 2). 동물플랑크 톤 분류군별 연구목적에 따라 고안된 종 특이 프라이머를 정 리한 내용은 Table 2와 같다. 종 특이 프라이머는 종 특이성 (species-specificity)에 따라 잠재적 분류 대상을 축소시켜 보 다 정확한 종 동정 결과를 도출하거나 대상 분류군과의 일치 여부 또는 표적 (target) 종의 존재 여부 등을 분석하는 데 활 용될 수 있다.

    선정한 프라이머는 PCR 반응액 (reaction buffer), 증류수, 뉴클레오시드3인산 (dNTP), Tap 중합효소 (polymerase), 추출 한 DNA 주형 (template) 등과 적정량 배합되어 PCR 증폭에 사용되며, 편의에 따라 반응액, dNTP, Tap 중합효소와 같이 PCR 수행에 필요한 구성성분을 혼합하여 1회 분량씩 진공 건조시킨 제품을 사용할 수 있다 (e.g. AccuPower® Taq PCR PreMix, Bioneer). PCR은 DNA의 변성 (denaturation), 프라 이머의 결합 (annealing), DNA의 신장 (elongation)의 과정을 반복하여 추출한 DNA의 목표한 영역을 증폭시키는 원리로, 각 단계의 온도와 시간을 적절히 설정하는 것이 중요하다. 특 히, 프라이머의 결합 온도 (annealing temperature, Ta)는 너무 낮을 경우 비특정 DNA 조각 (non-specific DNA fragment)이 증폭되어 전기영동 시 여러 개의 밴드 (band)가 나타날 수 있 으며, 높을 경우 증폭하고자 하는 DNA의 수율 (yield)이 낮 아지고 프라이머가 잘못 결합되어 순도가 낮아질 수 있기 때문에, 이중 가닥의 DNA가 단일 가닥으로 분리되는 온도 (melting temperature, Tm)를 기반으로 적절한 Ta를 설정해 야 할 필요가 있다 (Rychlik et al., 1990).

    PCR 산물 (product)은 아가로스겔 (agarose gel, 1~2%)을 이용하여 전기영동 (electrophoresis) 실시, 밴드 (band)의 유무 를 통해 시각적으로 확인할 수 있다.

    4. PCR 증폭 산물의 염기서열 분석

    PCR 산물의 염기서열분석, 즉 시퀀싱을 위해서는 정제 키 트 (e.g. Qiagen사의 QIAQuick PCR purification kit), 혹은 밴 드 상태라면 겔 추출 키트 (e.g. Qiagen사의 QIAquick Gel extraction kit)를 이용한 정제 과정이 필요하다. 시퀀싱에 사 용되는 대표적인 분석 키트로는 thermofisher사의 BigDye© Terminator v.3.1 Cycle Sequencing kit가 있으며, 본 키트 로 표지된 (labelled) PCR 산물은 capillary 시퀀서 (capillary sequencer)에서 PCR 증폭에 사용된 동일한 프라이머 세트 에 의해 단방향 또는 양방향으로 염기서열분석이 이루어진 다 (Elías-Gutiérrez et al., 2008;Garcia-Morales and Elías- Gutiérrez, 2013;Baek et al., 2016;Makino et al., 2017). 본 과정은 업체 (e.g. Macrogen, Bioneer)에 의뢰하여 수행 가능 하며, 이때, 단방향 대비 양방향으로 시퀀싱 할 때보다 정확 한 서열을 바탕으로 종 동정이 이루어질 수 있다.

    분석된 서열은 Molecular Evolutionary Genetics Analysis (MEGA)와 같은 프로그램을 사용하여 정렬 (alignment) 과정 을 통해 보정 가능하며, 프로그램 내 Kimura two parameter (K2P) 거리 모델 (Kimura, 1980)을 이용하여 서열의 편차 (divergence)을 계산하고 이를 바탕으로 계통수 (phylogenetic tree)를 구성하는 등 종내, 종간 유사도 분석이 가능하다. 이 때, 비교 분석에 필요한 동일종 혹은 타종의 서열 정보는 National Center for Biotechnology Information (NCBI)의 GenBank에서 추출 가능하다.

    메타바코딩 (metabarcoding)을 통한 동물플랑크톤 군집 분석

    초기 종 동정을 위해 설계된 바코딩 기법은 DNA 단일 가닥 (single stand)의 염기서열을 분석하는 생어법 (sanger sequencing, Sanger et al., 1977)을 기반으로 하기 때문에 식 별 가능한 표본 수에 제한이 있어 복수의 종을 포함하는 벌 크 (bulk) 시료 및 환경 시료와 같이 높은 처리량을 필요로 하는 군집 수준의 종 동정 작업에는 한계가 있다 (Shokralla et al., 2012). 하지만 이후 기술이 발전함에 따라 유전체 (genome)를 무수히 많은 조각으로 나누어 각각의 DNA 주 형으로부터 염기서열을 병렬로 읽어내 그 조각을 조립하여 전체 유전체의 정보를 얻을 수 있는 차세대 염기서열 분석법 (next-generation sequencing, NGS)이 도입되었으며, 이는 다수의 표본으로부터 여러 생물종을 동시에 식별하는 메타 바코딩 (metabarcoding) 분석을 가능하게 하였다.

    동물플랑크톤의 경우, 어류 생산량과 관련하여 군집 연구 가 활발히 이루어지고 있는 해양생태계에서 비교적 빠르게 메타바코딩 기법을 적용하여 벌크 시료를 분석, 기존의 형태 학적 분류 체계에 따른 결과와 비교를 통해 DNA 바코드 레 퍼런스 라이브러리를 구축 및 보완하기 위한 연구가 수행되 어왔으며 (Lindeque et al., 2013;Abad et al., 2016;Harvey et al., 2017;Hirai et al., 2017a, 2017b;Djurhuus et al., 2018;Bucklin et al., 2019;Schroeder et al., 2020), 최근 국 내에서도 우리나라 근해를 대상으로 분류학적 동정 데이터와 DNA 바코드 데이터를 비교 검토하려는 노력이 이루어지고 있다 (Kim et al., 2019;Kim et al., 2020;Kim et al., 2021). 담수생태계에서 또한 해양생태계와 유사하게 분류학적 불확 실성을 없애고 종 동정의 어려움이 존재하는 유생 시기의 종 을 특정하거나, 부차시료 (subsample) 추출로 확인의 한계가 존재하는 저밀도의 종을 확인하여 온전한 종 조성과 다양성 을 측정하는 데 DNA 바코딩 기법을 활용될 수 있도록 동물 플랑크톤 벌크 시료를 이용한 메타바코딩 연구가 수행되고 있다 (Chain et al., 2016;Makino et al., 2017;Xiong et al., 2020).

    뿐만 아니라 메타바코딩 기법은 형태 기반의 종 동정 결 과와의 비교 검토 과정을 통해 구축된 고해상도의 동물플 랑크톤 DNA 바코드 라이브러리를 바탕으로 환경 유전자 (environmental DNA, eDNA)의 분류학적 조성을 분석 가 능하게 함으로써, 효율적인 생물다양성 (biodiversity) 조사와 전통적으로 수행되고 있는 형태학적 분류 체계의 한계를 보 완한 생물평가 (bioassessment)를 수행할 수 있는 기회를 제 공한다 (Xie et al., 2017;Yang and Zhang, 2020).

    동물플랑크톤 메타바코딩을 위한 시료의 채집-보존-전 처리 및 DNA 추출 방법은 Table 3에 요약하여 제시하였다 (Lindeque et al., 2013;Abad et al., 2016;Harvey et al., 2017;Hirai et al., 2017a;Xie et al., 2017;Djurhuus et al., 2018;Bucklin et al., 2019;Schroeder et al., 2020;Yang and Zhang, 2020;Kim et al., 2021).

    추출된 DNA는 분광 측광법 (spectrophotometry, e.g. Nanodrop)과 투시측정법 (fluorometry, e.g. Qubit)을 통해 이중 가닥 DNA (double-stranded DNA)의 양을 확인한 뒤, 메타바코딩을 실시한다. 메타바코딩 시 두 차례의 PCR이 수 행되는데, 1차 PCR은 표적하는 특정 영역을 증폭시키기 위 한 과정으로 사용하고자 하는 NGS 플랫폼 (platform)의 어 댑터 (adaptor)를 붙이는 작업을 제외하고는 DNA 바코딩의 PCR 증폭부터 증폭 산물의 정제 과정과 대체로 유사하게 진 행된다.

    단, 주로 mtCOI 영역을 분자 마커로 사용했던 DNA 바코딩과는 달리, 메타바코딩의 경우 18S 리보솜 RNA (18S ribosomal RNA, 18S rRNA), 28S 리보솜 RNA (28S ribosomal RNA, 28S rRNA), mtCOI 등의 다양한 영역을 분 자 마커로 사용한다 (Table 4). 한편, 18S rRNA 영역은 분 류 해상도를 목 (Order)-과 (Family) 수준으로 제한하는 반면, 28S rRNA 및 mtCOI은 속 (Genus)-종 (Species) 수준의 해상 도를 갖는다는 연구 결과가 있다 (Pearman et al., 2014; Hirai et al., 2015b; Harvey et al., 2016). 따라서 메타바코딩을 통 한 동물플랑크톤 시공간적 군집 분석 시 여러 마커의 복합적 인 사용은 종 조성 및 다양성의 해상도를 높일 수 있는 방안 이 될 수 있다 (Meredith et al., 2021).

    2차 PCR은 1차 PCR 산물의 시료 구분을 위해 인덱스 (index)를 부착하여 1차 PCR과 동일 조건 하에 수행된다. 2 차 PCR 산물은 NGS 플랫폼을 이용하여 대량의 염기서열을 분석하는 데 사용되며, 이 과정은 주로 유전자 분석의 전문기 술을 가진 연구자와의 협업 또는 분석기관에 의뢰하여 분석 을 수행할 수 있다. 플랫폼에 따라 시퀀서 (sequencer)를 통 해 자동으로 읽어진 한 라이브러리의 염기서열 정보 - i.e. 리 드 (read)의 길이, 1회 가동 (run) 시 리드 수 및 가동시간 등 이 상이하기 때문에 연구 목적에 따라 적절한 플랫폼의 선 정이 필요하며, 최근 가장 보편적으로 사용되는 NGS 플랫 폼은 Illumina사의 MiSeq이다 (Abad et al., 2016;Banerji et al., 2018;Bucklin et al., 2019;Kim et al., 2021;Meredith et al., 2021). 분석 추출된 대량의 양방향의 염기서열은 파 이프라인 (pipeline, e.g. Mother, Qiime)을 이용, 표적 유전 자 영역의 레퍼런스 데이터베이스 (database)를 기반으로 선 정한 파이프라인의 튜토리얼 (tutorial)에 따라 리드 데이터를 OTU로 처리할 수 있다. 이때, OTU를 종 수준으로 해석하기 위해서는 Basic Local Alignment Search Tool (BLAST) 검 색을 통해 NCBI의 GenBank에서 유사 분류군의 염기서열을 추출, OTU와의 염기서열 유사성 (identity)이 97%~99% 이 상일 경우 종 수준으로 동정하는 것이 일반적이며, 그 이하의 유사성을 가질 경우 속, 과, 목 수준으로 넓게 판단되며 보다 정확한 종 동정을 위해서는 계통수 분석이 추가적으로 요구 된다. OTU는 다양한 통계 프로그램 (e.g. R)을 사용하여 종 조성 및 군집 내 상대적인 비율, 다양도 지수 분석 등에 활용 가능하다. 반면, 분석 결과는 염기서열의 유사성에 기반한 종 들을 순위로 제공하므로 이들 정보로부터 정확한 종을 선별 하기 위해서는 분류학적 지식과 시료가 채집된 수역의 생물 정보를 고려할 필요가 있다 (Fig. 2).

    메타바코딩 (metabarcoding)을 통한 동물플랑크톤 섭식 먹이원 분석

    NGS 플랫폼에 의해 리드 길이의 호환성이 다양해짐에 따 라 메타바코딩 기법을 통해 생물의 위 내용물 (gut content)과 같이 분해되어 비교적 짧은 길이의 DNA를 포함하는 시료 의 분석 또한 가능하게 되었다 (Taberlet et al., 2012;Yang et al., 2017). 포식자의 소화기관에 존재하는 먹이생물의 흔적 은 포식자의 섭식 성향과 먹이 선택성을 유추할 수 있게 해 주는 중요한 단서로, 육안 또는 현미경 하에서 대상 생물이 섭식한 먹이를 직접 확인하는 위 내용물 분석 방법이 가장 보편적으로 사용된다 (Harris et al., 2000;Yoon et al., 2016). 하지만 이 경우, 위 내용물에 잔존해 있는 개체 또는 개체의 흔적을 기반으로 분석이 이루어지기 때문에 소화효소에 대 한 내성의 차이, 섭식 이후 시간 경과 등 다양한 요인에 의해 확인이 불가능한 개체가 발생, 섭식된 생물조성의 편차가 발 생하고, 결과적으로 해석의 오차가 크게 발생할 수 있다. 이 런 측면에서 소화기관에 남아 있는 먹이 생물의 유전자를 분 석하는 방법은 이와 같은 오차를 크게 줄일 수 있으며, 유전 자량에 기반한 상대적으로 객관적인 해석을 가능하게 한다 (Symondson, 2002;Carreon-Martinez et al., 2011;Jo et al., 2016;Oh et al., 2020a).

    먹이망 내 생물학적 상호작용 분석 및 해석에 중요한 위 내용물의 유전자 분석은 먹이생물의 분류군을 고려한 분자 마커의 선정만 이루어진다면 기본적으로 앞서 설명한 DNA 바코딩/메타바코딩 방법과 동일한 과정을 거쳐 수행 가능하 다 (Fig. 3). 단, 동물플랑크톤의 경우, 개체의 크기가 작아 해 부를 통한 소화기관의 추출 작업에 어려움이 있기 때문에 개 체 전신 (whole body)로부터의 DNA 추출이 불가피하며, 이 때, 개체를 둘러싸고 있는 원수 (surrounding water) 내 DNA, 개체 외벽에 남아 있는 DNA (extracellular DNA)와 같은 외 부 유전자로부터의 오염을 완전히 배제할 수 없다는 문제점 이 있어 위 내용물의 DNA만을 추출하기 위해서는 부가적인 전처리 과정을 필요로 한다 (Oh et al., 2020a).

    상대적으로 개체 크기가 크고 (보통 1 mm 이상) 외골 격 구조가 단단한 중대형 갑각류 (crustacean-copepods 및 cladocerans) 종은 개체로부터 위 내용물 추출하거나 개체의 extracellular DNA를 제거하기 위한 물리화학적 처리에 대한 내성이 강하기 때문에 DNA를 기반으로 한 위 내용물 연구 가 비교적 빠르게 수행된 반면 (Craig et al., 2013;Ho et al., 2017), 육안으로 처리 과정의 확인이 어렵고 lorica라고 불리 는 연질의 외형질을 가지는 윤충류의 경우에는 비교적 최근 위 내용물 DNA 분석을 위한 연구가 시작되어 현재 분석 방 법에 대한 연구가 진행 중이다 (Oh et al., 2020a).

    오염 DNA (contaminated DNA) 제거에 효과적인 다양 한 화학약품 (e.g. 솔라렌 (Psoralen), 메톡살렌 (Xanthotoxin, 8-Methoxypsorale), 상업용 표백제 (bleach). 과산화수 소 (Hydrogen peroxide)) 중 차아염소산나트륨 (sodium hypochlorite, NaClO) 성분을 포함하는 상업용 표백제가 가 장 보편적으로 사용된다 (Greenstone et al., 2012;Oh et al., 2020a;Chae et al., 2021). 동물플랑크톤의 주요 분류군인 윤 충류, 지각류, 요각류는 각기 다른 외형질 형태를 가지고 있어 표백제 처리에 대한 내성이 다르며, 특히 윤충류의 경우 현미 경을 통해서도 외형질 변화를 관찰하기 쉽지 않을 정도로 크 기가 작고 종에 따라 상이한 외형질 구조를 가지기 때문에 전 처리 조건을 확립하는 데 있어 대상 종의 외형질 특성을 고려 는 필수적이다 (Table 5). 표백제 처리에 대한 동물플랑크톤 종의 내성 정도를 바탕으로 처리 농도와 노출 시간을 조절하 여 전처리 과정을 수행하게 되면 개체 외형질은 파괴하지 않 고 extracellular DNA 제거가 가능하다 (Oh et al., 2020a).

    오염 DNA 제거를 위해 전처리된 동물플랑크톤 개체는 처 리한 약품의 효과가 지속되지 않도록 증류수를 이용하여 충 분히 세척 (wash)하는 작업이 필요하다. 요각류와 같이 개체 크기가 큰 동물플랑크톤 종의 경우 전처리부터 세척 작업까 지 육안으로 수행 가능하지만 (Chae et al., 2021), 윤충류와 같은 소형종의 경우 필터지를 이용하여 처리를 위한 약품 및 세척 작업에 필요한 증류수를 여과하는 방식으로 작업 가능 하다 (Oh et al., 2020a). 개체 및 필터지 시료에서 모두 동물 플랑크톤의 위 내용물 DNA 추출이 가능하지만, 여과 등 작 업 단계가 많아질수록 외부로부터의 시료 오염 혹은 시료간 오염의 가능성이 증가하기 때문에 주의를 요하여 작업해야 할 필요가 있다.

    결 론

    동물플랑크톤은 일반적으로 수체를 대변할 수 있는 정점에 서 원수의 여과 또는 플랑크톤 네트를 이용한 직접 여과를 통 해 채집되며, 실내에서 동정 및 계수하는 과정을 통해 수생태 계 내 서식하고 있는 동물플랑크톤 군집에 대한 정량적 생물 정보를 얻을 수 있다. 이 과정에서 종의 동정, 계수를 위한 농 축과 부차시료 추출의 차이, 연구자의 전문성 차이, 표현형 가 소성, 유생 시기의 종 동정 등과 같은 다양한 요인에 의해 계 산 결과의 편차가 발생할 수 있다. 또한, 현장에서의 시료 채 집 시 정점의 선정 (e.g. 수변부, 중앙부 등), 동물플랑크톤 네 트의 끌기 방법 (e.g. 수직끌기, 수평끌기 등) 및 거리 (e.g. 수 심에 따라; 수심<20 m - 전층 끌기, 수심>20 m - 20 m 끌기 등) 등 조사 방법에 따라 시료의 대표성이 다르게 나타날 수 있다 (Oh et al., 2020b). 따라서, DNA 기반의 군집 분석은 이 와 같은 편차를 보완해줄 수 있는 유용한 수단이 될 수 있다.

    향후 전통적인 종 동정 방법과 상호 보완되어 종 다양성을 포함한 군집지수 및 평가지수의 객관적 정량 지표 산정에 활 용되기 위해서는 국내 서식 동물플랑크톤 종의 분류학적 체 계의 정리와 이에 따른 유전정보의 라이브러리 구축이 우선 될 필요가 있다. 또한, 동물플랑크톤뿐만 아니라 먹이원이 되 는 식물플랑크톤 및 원생생물의 유전 정보 라이브러리리의 구축과 적절한 분석 방법의 개발을 통해 기존의 방법 (e.g. 육 안 동정, 현미경 동정)으로 분석에 한계가 있었던 위 내용물 과 같은 저질 (low-quality)의 시료에도 DNA 분석 기법이 적 용이 가능해짐에 따라 동물플랑크톤의 생물학적 상호작용 연구에 있어 중요한 섭식한 먹이원을 정성/정량적으로 분석 할 수 있을 것으로 기대된다.

    적 요

    동물플랑크톤 군집 연구에 DNA 바코딩과 같은 DNA 분 석 기법의 적용은 분류형태학을 기반으로 하는 전통적인 종 동정 시 발생할 수 있는 문제 (e.g. 개체의 표현형 가소성에 의한 오동정, 유사종 및 자매종, 유생 시기의 종 동정의 어려 움)를 보완할 수 있다. 최근 DNA 시퀀싱 기술의 발전으로 다 양한 수생태계의 동물플랑크톤 군집은 물론, 육안 및 현미경 을 통해 구분하는 데 한계가 있는 동물플랑크톤의 위 내용 물에 대한 DNA 기반 군집 분석 또한 가능하게 되었으며, 이 는 동물플랑크톤의 섭식 먹이원 분석을 통한 생물학적 상호 작용을 이해를 돕는다. 본 논문은 동물플랑크톤 연구에 DNA 분석 기법이 활용된 사례 (e.g. DNA 바코딩을 이용한 계통분 류학적 연구, 메타바코딩을 이용한 군집 분석, 위 내용물 분 석)를 소개하고 분석 방법을 요약하여, 최종적으로 향후 이를 활용하고자 하는 연구자들에게 연구 접근성을 높일 수 있도 록 방법론적인 기초 지식을 제공하고자 하였다.

    저자정보

    오혜지 (경희대학교 박사수료), 채연지 (경희대학 교 석사수료), 최예림 (경희대학교 석사과정), 구도영 (경희 대학교 석사과정), 허유지 (순천대학교 석사과정), 곽인실 (전남대학교 교수), 조현빈 (부산대학교 환경·에너지연구소 연구교수), 박영석 (경희대학교 교수), 장광현 (경희대학교 교수), 김현우 (순천대학교 교수)

    저자 기여도

    개념설정: H.J. Oh, K.H. Chang & H.W. Kim, 자료제공: Y.J. Chae, Y. Choi, D. Ku & Y.J. Heo, 자료관리: H.J. Oh & K.H. Chang, 원고 초안작성: H.J. Oh & K.H. Chang, 원고 교정: I.S. Kwak, H. Jo, Y.S. Park, K.H. Chang & H.W. Kim, 원고 편집: H.J. Oh & K.H. Chang, 과제관리: Y.S. Park, 연구비 수주: Y.S. Park

    이해관계

    이 논문에는 이해관계 충돌의 여지가 없습니다.

    연구비

    본 결과물은 환경부의 재원으로 한국환경산업기술원 수생태계 건강성 확보 기술개발사업의 지원을 받아 연구되 었습니다 (과제번호: 2020003050003).

    Figure

    KSL-54-3-156_F1.gif

    Process of DNA barcoding analysis for zooplankton.

    KSL-54-3-156_F2.gif

    Process of DNA metabarcoding analysis for zooplankton community using next-generation sequencing.

    KSL-54-3-156_F3.gif

    Brief process of DNA analysis for zooplankton gut contents.

    Table

    Summary of representative universal primers binding mitochondrial COI region for zooplankton DNA barcoding analysis.

    Introduction to species-specific primers by zooplankton classification, (A)~(E) refer to the target gene region of each primer - (A) small-subunit ribosomal RNA (SSU rRNA) & cytochrome b (cyt b) of mitochondrial gene; (B) mitochondrial cytochrome 1 oxidase subunit I (mtCOI); (C) large-subunit ribosomal RNA (LSU rRNA) of nuclear gene; (D) MT-ND2 (mitochondrial gene NADH dehydrogenase subunit 2); (E) 18S SSU rRNA.

    Summary of sample collection-preservation-pretreatment and DNA extraction methods for zooplankton metabarcoding.

    Introduction to primers targeting 3 different gene region - 18S small-subunit ribosomal RNA, 18S SSU rRNA; 28S large-subunit ribosomal RNA, 28S LSU rRNA; mitochondrial cytochrome c oxidase subunit I, mtCOI for zooplankton metabarcoding.

    The responses of some zooplankton species to commercial bleach treatment (final concentration of 2.5%); based on the minimum time it takes before the body content is lost due to the disintegration of whole body after the treatment.

    Reference

    1. Abad, D. , A. Albaina, M. Aguirre, A. Laza-Martinez, I. Uriarte, A. Iriarte, F. Villate and A. Estonba.2016. Is metabarcoding suitable for estuarine plankton monitoring? A comparative study with microscopy. Marine Biology 163(7): 1-13.
    2. Baek, S.Y. , K.H. Jang, E.H. Choi, S.H. Ryu, S.K. Kim, J.H. Lee, Y.J. Lim, J. Lee, J. Jun, M. Kwak, Y.S. Lee, J.S. Hwang, B.A. Venmathi Maran, C.Y. Chang, I.H. Kim and U.W. Hwang.2016. DNA barcoding of metazoan zooplankton copepods from South Korea. PloS One 11(7): e0157307.
    3. Banerji, A. , M. Bagley, M. Elk, E. Pilgrim, J. Martinson and J. Santo Domingo.2018. Spatial and temporal dynamics of a freshwater eukaryotic plankton community revealed via 18S rRNA gene metabarcoding. Hydrobiologia 818(1): 71-86.
    4. Belyaeva, M. and D.J. Taylor.2009. Cryptic species within the Chydorus sphaericus species complex (Crustacea: Cladocera) revealed by molecular markers and sexual stage morphology. Molecular Phylogenetics and Evolution 50(3): 534-546.
    5. Bhavan, P.S. , R. Udayasuriyan, C. Vadivalagan, R. Kalpana and S. Umamaheswari.2016. Diversity of zooplankton in four perennial lakes of Coimbatore (India) and molecular characterization of Asplanchna intermedia, Moina micrura, Mesocyclops edax and Cypris protubera through mt-COI gene. Journal of Entomology and Zoology Studies 4(2): 183-197.
    6. Blanco-Bercial, L. , A. Cornils, N. Copley and A. Bucklin.2014. DNA barcoding of marine copepods: assessment of ana lytical approaches to species identification. PLoS Currents 6: ecurrents.tol.cdf8b74881f87e3b01d56b43791626d2.
    7. Briski, E. , M.E. Cristescu, S.A. Bailey and H.J. MacIsaac.2011. Use of DNA barcoding to detect invertebrate invasive species from diapausing eggs. Biological Invasions 13(6): 1325-1340.
    8. Bryant, P.J. and T. Arehart.2021. Diversity and life-cycle analysis of Pacific Ocean zooplankton by videomicroscopy and DNA barcoding: Crustacea.
    9. Bucklin, A. 2000. Methods for population genetic analysis of zooplankton, pp. 533-570. In: ICES zooplankton methodology manual. Academic Press.
    10. Bucklin, A. , R.R. Hopcroft, K.N. Kosobokova, L.M. Nigro, B.D. Ortman, R.M. Jennings and C.J. Sweetman.2010a. DNA barcoding of Arctic Ocean holozooplankton for species identification and recognition. Deep Sea Research Part II: Topical Studies in Oceanography 57(1-2): 40-48.
    11. Bucklin, A. , B.D. Ortman, R.M. Jennings, L.M. Nigro, C.J. Sweetman, N.J. Copley, T. Sutton and P.H. Wiebe.2010b. A “Rosetta Stone” for metazoan zooplankton: DNA barcode analysis of species diversity of the Sargasso Sea (Northwest Atlantic Ocean). Deep Sea Research Part II: Topical Studies in Oceanography 57(24-26): 2234-2247.
    12. Bucklin, A. , P.K. Lindeque, N. Rodriguez-Ezpeleta, A. Albaina and M. Lehtiniemi.2016. Metabarcoding of marine zooplankton: prospects, progress and pitfalls. Journal of Plankton Research 38(3): 393-400.
    13. Bucklin, A. , H.D. Yeh, J.M. Questel, D.E. Richardson, B. Reese, N.J. Copley and P.H. Wiebe.2019. Time-series metabarcoding analysis of zooplankton diversity of the NW Atlantic continental shelf. ICES Journal of Marine Science 76(4): 1162-1176.
    14. Carreon-Martinez, L. , T.B. Johnson, S.A. Ludsin and D.D. Heath.2011. Utilization of stomach content DNA to determine diet diversity in piscivorous fishes. Journal of Fish Biology 78: 1170-1182.
    15. Chae, Y.J. , H.J. Oh, K.H. Chang, I.S. Kwak and H. Jo.2021. Application of Next-Generation Sequencing for the Determination of the Bacterial Community in the Gut Contents of Brackish Copepod Species (Acartia hudsonica, Sinocalanus tenellus, and Pseudodiaptomus inopinus). Animals 11(2): 542.
    16. Chain, F.J. , E.A. Brown, H.J. MacIsaac and M.E. Cristescu.2016. Metabarcoding reveals strong spatial structure and temporal turnover of zooplankton communities among marine and freshwater ports. Diversity and Distributions 22(5): 493-504.
    17. Conde-Porcuna, J.M. , J. Veiga, E. Moreno, L. Jimenez, E. Ramos-Rodriguez and C. Perez-Martinez.2021. Spatiotemporal genetic structure in the Daphnia pulex complex from Sierra Nevada lakes (Spain): reproductive mode and first record of North American D. cf. pulex in European alpine lakes. Journal of Plankton Research 43(3): 380- 395.
    18. Craig, C. , W.J. Kimmerer and C.S Cohen.2013. A DNA-based method for investigating feeding by copepod nauplii. Journal of Plankton Research 36: 271-275.
    19. DeSalle, R. and P. Goldstein.2019. Review and interpretation of trends in DNA barcoding. Frontiers in Ecology and Evolution 7: 302.
    20. Djurhuus, A. , K. Pitz, N.A. Sawaya, J. Rojas-Marquez, B. Michaud, E. Montes, F. Muller-Karger and M. Breitbart.2018. Evaluation of marine zooplankton community structure through environmental DNA metabarcoding. Limnology and Oceanography: Methods 16(4): 209-221.
    21. Duggan, I.C. , K.V. Robinson, C.W. Burns, J.C. Banks and I.D. Hogg.2012. Identifying invertebrate invasions using morphological and molecular analyses: North American Daphnia ‘pulex’ in New Zealand fresh waters. Aquatic Invasions 7(4): 585-590.
    22. Elias-Gutierrez, M. , F.M. Jeronimo, N.V. Ivanova, M. Valdez- Moreno and P.D. Hebert.2008. DNA barcodes for Cladocera and Copepoda from Mexico and Guatemala, highlights and new discoveries. Zootaxa 1839(1): 1-42.
    23. Elias-Gutierrez, M. and M. Valdez-Moreno.2008. A new cryptic species of Leberis Smirnov, 1989 (Crustacea, Cladocera, Chydoridae) from the Mexican semi-desert region, highlighted by DNA barcoding. Hidrobiológica 18(1): 63-74.
    24. Elias Gutierrez, M. , M. Valdez-Moreno, J. Topan, M.R. Young and J.A. Cohuo-Colli.2018. Improved protocols to accelerate the assembly of DNA barcode reference libraries for freshwater zooplankton. Ecology and Evolution 8(5): 3002-3018.
    25. Folmer, O. , M. Black, W. Hoeh, R. Lutz and R. Vrijenhoek.1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294-299.
    26. Fonseca, V.G., G.R. Carvalho, W. Sung, H.F. Johnson, D.M. Power, S.P. Neill, M. Packer, M.L. Blaxter, P.J.D. Lambshead, W.K. Thomas and S. Creer.2010. Second-generation environmental sequencing unmasks marine metazoan biodiversity. Nature Communications 1(1): 1-8.
    27. Garcia-Morales, A.E. and M. Elias Gutierrez.2013. DNA barcoding of freshwater Rotifera in Mexico: Evidence of cryptic speciation in common rotifers. Molecular Ecology Resources 13(6): 1097-1107.
    28. Geller, J. , C. Meyer, M. Parker and H. Hawk.2013. Redesign of PCR primers for mitochondrial cytochrome c oxidase subunit I for marine invertebrates and application in alltaxa biotic surveys. Molecular Ecology Resources 13(5): 851-861.
    29. Greenstone, M.H. , D.C. Weber, T.A. Coudron, M.E. Payton and J.S. Hu.2012. Removing external DNA contamination from arthropod predators destined for molecular gut-content analysis. Molecular Ecology Resources 12: 464-469.
    30. Hajibabaei, M. , J.R. dewaard, N.V. Ivanova, S. Ratnasingham, R.T. Dooh, S.L. Kirk, P.M. Mackie and P.D. Hebert.2005. Critical factors for assembling a high volume of DNA barcodes. Philosophical Transactions of the Royal Society B: Biological Sciences 360(1462): 1959-1967.
    31. Harris, R. , P. Wiebe, J. Lenz, H.R. Skjoldal and M. Huntley.2000. ICES zooplankton methodology manual. Academic Press, San Diego, p. 684.
    32. Harvey, J.B. , S.B. Johnson, J.L. Fisher, W.T. Peterson and R.C. Vrijenhoek.2017. Comparison of morphological and next generation DNA sequencing methods for assessing zooplankton assemblages. Journal of Experimental Marine Biology and Ecology 487: 113-126.
    33. Hebert, P.D.N. , A. Cywinska, S.L. Ball and J.R. DeWaard.2003. Biological identifications through DNA barcodes. Proceedings of the Royal Society of London Series B-Biological Sciences 270(1512): 313-321.
    34. Hillis, D.M. , B.K. Mabel and C. Moritz.1996. Application of molecular systematics: The state of the field and a look to the future. Molecular Systematics. Sinauer. Sunderland. pp. 515-543.
    35. Hirai, J. , S. Katakura, H. Kasai and S. Nagai.2017a. Cryptic zooplankton diversity revealed by a metagenetic approach to monitoring metazoan communities in the coastal waters of the Okhotsk Sea, Northeastern Hokkaido. Frontiers in Marine Science 4: 379.
    36. Hirai, J. , S. Nagai and K. Hidaka.2017b. Evaluation of metagenetic community analysis of planktonic copepods using Illumina MiSeq: comparisons with morphological classification and metagenetic analysis using Roche 454. PloS One 12(7): e0181452.
    37. Ho, T.W. , J.S. Hwang, M.K. Cheung, H.S. Kwan and C.K. Wong.2017. DNA-based study of the diet of the marine calanoid copepod Calanus sinicus. Journal of Experimental Marine Biology and Ecology 494: 1-9.
    38. Ishida, S. , A.A. Kotov and D.J. Taylor.2006. A new divergent lineage of Daphnia (Cladocera: Anomopoda) and its morphological and genetical differentiation from Daphnia curvirostris Eylmann, 1887. Zoological Journal of the Linnean Society 146(3): 385-405.
    39. Jeffery, N.W. , M. Elias-Gutierrez and S.J. Adamowicz.2011. Species diversity and phylogeographical affinities of the Branchiopoda (Crustacea) of Churchill, Manitoba, Canada. PLoS One 6(5): e18364.
    40. Jo, H. , M. Ventura, N. Vidal, J.S. Gim, T. Buchaca, L.A. Barmuta, E. Jeppesen and G.J. Joo.2016. Discovering hidden biodiversity: the use of complementary monitoring of fish diet based on DNA barcoding in freshwater ecosystems. Ecology and Evolution 6: 219-232.
    41. Kang, J.H. , K.H. Yu, S.K. Kim, J.Y. Park, B.S. Kim and C.M. An.2010. Species identification and genetic structure of octopus minor from Korea and China on the basis of partial sequences of mitochondrial Cytochrome Oxidase I. The Korean Journal of Malacology 26(4): 285-290.
    42. Kim, D.K. , K. Park, H. Jo and I.S. Kwak.2019. Comparison of water sampling between environmental DNA metabarcoding and conventional microscopic identification: a case study in Gwangyang Bay, South Korea. Applied Science 9: 3272.
    43. Kim, G. , H.K. Kang, C.G. Kim, J.H. Choi and S. Kim.2021. Comparison of morphological analysis and DNA metabarcoding of crustacean mesozooplankton in the Yellow Sea. Ocean and Polar Research 43(1): 45-51.
    44. Kim, H. , C.R. Lee, S.K. Lee, S.Y. Oh and W. Kim.2020. Biodiversity and community structure of mesozooplankton in the marine and coastal national park areas of Korea. Diversity 12: 233.
    45. Kimura, M. 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16: 111-120.
    46. Lee, S.H. , W.C. Lee and J.W. Back.2011. Comparative study of DNA extraction method in meiofauna. Korean Journal of Environmental Biology 29(3): 138-143.
    47. Lindeque, P.K. , H.E. Parry, R.A. Harmer, P.J. Somerfield and A. Atkinson.2013. Next generation sequencing reveals the hidden diversity of zooplankton assemblages. PloS One 8(11): e81327.
    48. Machida, R.J. , M.U. Miya, M. Nishida and S. Nishida.2002. Complete mitochondrial DNA sequence of Tigriopus japonicus (Crustacea: Copepoda). Marine Biotechnology 4(4): 406-417.
    49. Machida, R.J. , M.U. Miya, M. Nishida and S. Nishida.2004. Large-scale gene rearrangements in the mitochondrial genomes of two calanoid copepods Eucalanus bungii and Neocalanus cristatus (Crustacea), with notes on new versatile primers for the srRNA and COI genes. Gene 332: 71-78.
    50. Makino, W. , H. Ohtsuki and J. Urabe.2013. Finding copepod footprints: a protocol for molecular identification of diapausing eggs in lake sediments. Limnology 14(3): 269- 282.
    51. Makino, W. , N. Maruoka, M. Nakagawa and N. Takamura.2017. DNA barcoding of freshwater zooplankton in Lake Kasumigaura, Japan. Ecological Research 32(4): 481- 493.
    52. Maruoka, N. , H. Ohtsuki, W. Makino and J. Urabe.2018. Rediscovery after almost 120 years: Morphological and genetic evidence supporting the validity of Daphnia mitsukuri (Crustacea: Cladocera). Zoological Science 35(5): 468- 475.
    53. Meredith, C. , J. Hoffman, A. Trebitz, E. Pilgrim, S. Okum, J. Martinson and E.S. Cameron.2021. Evaluating the performance of DNA metabarcoding for assessment of zooplankton communities in Western Lake Superior using multiple markers. Metabarcoding and Metagenomics 5: e64735.
    54. Messing, J. 1983. New M13 vectors for cloning. Methods in Enzymology 101: 20-78.
    55. Meyer, C.P. , J.B. Geller and G. Paulay.2005. Fine scale endemism on coral reefs: Archipelagic differentiation in turbinid gastropods. Evolution 59: 113-125.
    56. Montero-Pau, J. , A. Gomez and J. Munoz.2008. Application of an inexpensive and high-throughput genomic DNA extraction method for the molecular ecology of zooplanktonic diapausing eggs. Limnology and Oceanography: Methods 6(6): 218-222.
    57. Montiel-Martinez, A. , J. Ciros-Perez, E. Ortega-Mayagoitia and M. Elias-Gutierrez.2008. Morphological, ecological, reproductive and molecular evidence for Leptodiaptomus garciai (Osorio-Tafall 1942) as a valid endemic species. Journal of Plankton Research 30(10): 1079-1093.
    58. Nishida, H. and J. Sugiyama.1993. Phylogenetic relationships among Taphrina, Saitoella, and other higher fungi. Molecular Biology and Evolution 10(2): 431-436.
    59. Oh, H.J. , P.H. Krogh, H.G. Jeong, G.J. Joo, I.S. Kwak, S.J. Hwang, J.S. Gim, K.H. Chang and H. Jo.2020a. Pretreatment method for DNA barcoding to analyze gut contents of rotifers. Applied Sciences 10(3): 1064.
    60. Oh, H.J. , Y.J. Chae, D. Ku, Y.J. Kim, J.H. Wang, B. Choi, C.W. Ji, I.S. Kwak, Y.S. Park, G.S. Nam, Y.J. Kim and K.H. Chang.2020b. A comparative study on the information of zooplankton community based on towing type and depth in the lake ecosystems. Korean Journal of Environment and Ecology 53(4): 365-373.
    61. Pace, N.R. 1997. A molecular view of microbial diversity and the biosphere. Science 276(5313): 734-740.
    62. Park, C.H. , K.M. Kim, A. Elvebakk, O.S. Kim, G. Jeong and S.G. Hong.2015. Algal and fungal diversity in Antarctic lichens. Journal of Eukaryotic Microbiology 62(2): 196- 205.
    63. Park, C. , S.J. Ju, W. Park, H.W. Kim, S.R. Lee and J.H. Park.2018. The strategy of population maintenance by coastal copepod inferred from seasonal variations in abundance of adults and resting eggs. Ocean & Polar Research 40(4): 213-222.
    64. Pearman, J.K. , M.M. El-Sherbiny, A. Lanzen, A.M. Al-Aidaroos and X. Irigoien.2014. Zooplankton diversity across three Red Sea reefs using pyrosequencing. Frontiers in Marine Science 1: 27.
    65. Prendini, L. , R. Hanner and R. DeSalle.2002. Obtaining, storing and archiving specimens and tissue samples for use in molecular studies. In: Techniques in molecular systematics and evolution. Birkhauser, Basel. pp. 176-248.
    66. Prosser, S. , A. Martinez-Arce and M. Elias Gutierrez.2013. A new set of primers for COI amplification from freshwater microcrustaceans. Molecular Ecology Resources 13(6): 1151-1155.
    67. Quiroz-Vazquez, P. and M. Elias-Gutierrez.2009. A new species of the freshwater cladoceran genus Scapholeberis Schoedler, 1858 (Cladocera: Anomopoda) from the semidesert Northern Mexico, highlighted by DNA barcoding. Zootaxa 2236(1): 50-64.
    68. Robeson, M.S. , E.K. Costello, K.R. Freeman, J. Whiting, B. Adams, A.P. Martin and S.K. Schmidt.2009. Environmental DNA sequencing primers for eutardigrades and bdelloid rotifers. BMC Ecology 9(1): 1-10.
    69. Rychlik, W.J.S.W. , W.J. Spencer and R.E. Rhoads.1990. Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Research 18(21): 6409- 6412.
    70. Sambrook, J. , E.F. Fritsch and T. Maniatis.1989. Molecular cloning: a laboratory manual (No. Ed. 2). Cold spring harbor laboratory press.
    71. Sanger, F. , S. Nicklen and A.R. Coulson.1977. DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences, USA 74: 5463-5467.
    72. Schroeder, A. , D. Stanković, A. Pallavicini, F. Gionechetti, M. Pansera and E. Camatti.2020. DNA metabarcoding and morphological analysis-assessment of zooplankton biodiversity in transitional waters. Marine Environmental Research 160: 104946.
    73. Shokralla, S. , J.L. Spall, J.F. Gibson and M. Hajibabaei.2012. Nextgeneration sequencing technologies for environmental DNA research. Molecular Ecology 21(8): 1794-1805.
    74. Symondson, W.O.C.2002. Molecular identification of prey in predator diets. Molecular Ecology 11: 627-641.
    75. Taberlet, P. , E. Coissac, F. Pompanon, C. Brochmann and E. Willerslev.2012. Towards next-generation biodiversity assessment using DNA metabarcoding. Molecular Ecology 21(8): 2045-2050.
    76. Taylor, D.J. , C.R. Ishikane and R.A. Haney.2002. The systematics of Holarctic bosminids and a revision that reconciles molecular and morphological evolution. Limnology and Oceanography 47(5): 1486-1495.
    77. Truett, G.E. , P. Heeger, R.L. Mynatt, A.A. Truett, J.A. Walker and M.L. Warman.2000. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). Biotechniques 29(1): 52-54.
    78. Valdez-Moreno, M. , M. Mendoza-Carranza, E. Rendon-Hernandez, E. Alarcon-Chavira and M. Elias-Gutierrez.2021. DNA Barcodes Applied to a Rapid Baseline Construction in Biodiversity Monitoring for the Conservation of Aquatic Ecosystems in the Sian Ka’an Reserve (Mexico) and Adjacent Areas. Diversity 13(7): 292.
    79. Xie, Y., J. Wang, J. Yang, J.P Giesy, H. Yu and X. Zhang.2017. Environmental DNA metabarcoding reveals primary chemical contaminants in freshwater sediments from different land-use types. Chemosphere 172: 201-209.
    80. Xiong, W. , X. Huang, Y. Chen, R. Fu, X , Du, X. Chen and A. Zhan.2020. Zooplankton biodiversity monitoring in polluted freshwater ecosystems: a technical review. Environ mental Science and Ecotechnology 1: 100008.
    81. Yang, J. , X. Zhang, Y. Xie, C. Song, Y. Zhang, H. Yu and G.A. Burton.2017. Zooplankton community profiling in a eutrophic freshwater ecosystem-lake tai basin by DNA metabarcoding. Scientific Reports 7(1): 1-11.
    82. Yang, J. and X. Zhang.2020. eDNA metabarcoding in zooplankton improves the ecological status assessment of aquatic ecosystems. Environment International 134: 105230.
    83. Yoon, H. , A.R. Ko, J.H. Kang, J.K. Choi and S.J. Ju.2016. Diet of chaetognaths Sagitta crassa and S. nagae in the Yellow Sea inferred from gut content and fatty acid analyses. Ocean and Polar Research 38(1): 35-46.
    84. Zhang, X. , J. Liao, S. Xu, P. Liu, Q. Huang, H.J. Dumont and B.P. Han.2020. A set of new primers for COI (cytochrome oxidase subunit 1 mitochondrial gene) amplification in Phyllodiaptomus tunguidus (Copepoda, Calanoida, Diaptomidae). Mitochondrial DNA Part B 5(2): 1622-1624.
    85. Zhang, Y. , S. Xu, C. Sun, H. Dumont and B.P. Han.2021. A new set of highly efficient primers for COI amplification in rotifers. Mitochondrial DNA Part B 6(2): 636-640.
    86. Zhu D. , B.G.M. Jamieson, A. Hugall and C. Moritz.1994. Sequence evolution a and phylogenetic signal in control region and cytochrome b sequences of rainbow fishes. Molecular Biology and Evolution 11: 672-683.